ID: 1069037966

View in Genome Browser
Species Human (GRCh38)
Location 10:63665000-63665022
Sequence CAGCGAACAGCAGTGGTGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069037961_1069037966 13 Left 1069037961 10:63664964-63664986 CCAGAGGGGTGGAAGTCAGTGGC 0: 20
1: 67
2: 87
3: 104
4: 238
Right 1069037966 10:63665000-63665022 CAGCGAACAGCAGTGGTGGATGG No data
1069037957_1069037966 24 Left 1069037957 10:63664953-63664975 CCCTGCGGGATCCAGAGGGGTGG No data
Right 1069037966 10:63665000-63665022 CAGCGAACAGCAGTGGTGGATGG No data
1069037959_1069037966 23 Left 1069037959 10:63664954-63664976 CCTGCGGGATCCAGAGGGGTGGA No data
Right 1069037966 10:63665000-63665022 CAGCGAACAGCAGTGGTGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069037966 Original CRISPR CAGCGAACAGCAGTGGTGGA TGG Intergenic
No off target data available for this crispr