ID: 1069040648

View in Genome Browser
Species Human (GRCh38)
Location 10:63692296-63692318
Sequence ATGTTCACACATATGAATTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069040648_1069040651 9 Left 1069040648 10:63692296-63692318 CCTCAATTCATATGTGTGAACAT No data
Right 1069040651 10:63692328-63692350 TTGAGTCTTGAAGAGCTTACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069040648 Original CRISPR ATGTTCACACATATGAATTG AGG (reversed) Intergenic
No off target data available for this crispr