ID: 1069041361

View in Genome Browser
Species Human (GRCh38)
Location 10:63699029-63699051
Sequence CTATTTCCCCATTGCTACAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069041361_1069041362 3 Left 1069041361 10:63699029-63699051 CCAATGTAGCAATGGGGAAATAG No data
Right 1069041362 10:63699055-63699077 AATTCCTCCTGTCTCCTCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069041361 Original CRISPR CTATTTCCCCATTGCTACAT TGG (reversed) Intergenic
No off target data available for this crispr