ID: 1069044028

View in Genome Browser
Species Human (GRCh38)
Location 10:63723773-63723795
Sequence GAGGAACCCCTGACCCACTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069044020_1069044028 16 Left 1069044020 10:63723734-63723756 CCAGAGCTCCAAAATGGGTTTTT No data
Right 1069044028 10:63723773-63723795 GAGGAACCCCTGACCCACTGGGG No data
1069044019_1069044028 17 Left 1069044019 10:63723733-63723755 CCCAGAGCTCCAAAATGGGTTTT No data
Right 1069044028 10:63723773-63723795 GAGGAACCCCTGACCCACTGGGG No data
1069044021_1069044028 8 Left 1069044021 10:63723742-63723764 CCAAAATGGGTTTTTACGATCTT No data
Right 1069044028 10:63723773-63723795 GAGGAACCCCTGACCCACTGGGG No data
1069044018_1069044028 18 Left 1069044018 10:63723732-63723754 CCCCAGAGCTCCAAAATGGGTTT No data
Right 1069044028 10:63723773-63723795 GAGGAACCCCTGACCCACTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069044028 Original CRISPR GAGGAACCCCTGACCCACTG GGG Intergenic