ID: 1069045685

View in Genome Browser
Species Human (GRCh38)
Location 10:63741023-63741045
Sequence TGTCATGGCAATAGTGAGTT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069045685_1069045691 -7 Left 1069045685 10:63741023-63741045 CCGAACTCACTATTGCCATGACA No data
Right 1069045691 10:63741039-63741061 CATGACAGCACCAAGGGGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069045685 Original CRISPR TGTCATGGCAATAGTGAGTT CGG (reversed) Intergenic
No off target data available for this crispr