ID: 1069048851

View in Genome Browser
Species Human (GRCh38)
Location 10:63771090-63771112
Sequence AAGGCTCATCTGGAGGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069048851_1069048857 -5 Left 1069048851 10:63771090-63771112 CCTTCCTCCTCCAGATGAGCCTT No data
Right 1069048857 10:63771108-63771130 GCCTTTCCTGTCTTGGGTTGAGG No data
1069048851_1069048860 17 Left 1069048851 10:63771090-63771112 CCTTCCTCCTCCAGATGAGCCTT No data
Right 1069048860 10:63771130-63771152 GAAAGATTGTTTTAATTTATCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069048851 Original CRISPR AAGGCTCATCTGGAGGAGGA AGG (reversed) Intergenic
No off target data available for this crispr