ID: 1069049631

View in Genome Browser
Species Human (GRCh38)
Location 10:63778929-63778951
Sequence GGGTGGGGGTGGGATGGCTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069049631_1069049646 27 Left 1069049631 10:63778929-63778951 CCAAAGCCATCCCACCCCCACCC No data
Right 1069049646 10:63778979-63779001 ACTGGTCTCTGGTGCCAAAAAGG 0: 39
1: 472
2: 900
3: 1308
4: 1244
1069049631_1069049643 9 Left 1069049631 10:63778929-63778951 CCAAAGCCATCCCACCCCCACCC No data
Right 1069049643 10:63778961-63778983 AAAACTGTCTTCCACAAAACTGG 0: 98
1: 406
2: 706
3: 913
4: 929
1069049631_1069049644 16 Left 1069049631 10:63778929-63778951 CCAAAGCCATCCCACCCCCACCC No data
Right 1069049644 10:63778968-63778990 TCTTCCACAAAACTGGTCTCTGG 0: 16
1: 249
2: 558
3: 1169
4: 1339

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069049631 Original CRISPR GGGTGGGGGTGGGATGGCTT TGG (reversed) Intergenic
No off target data available for this crispr