ID: 1069049638

View in Genome Browser
Species Human (GRCh38)
Location 10:63778945-63778967
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069049638_1069049652 29 Left 1069049638 10:63778945-63778967 CCCACCCCATTATGGAAAAACTG No data
Right 1069049652 10:63778997-63779019 AAAGGTTGGGGATTCTTGCTGGG No data
1069049638_1069049643 -7 Left 1069049638 10:63778945-63778967 CCCACCCCATTATGGAAAAACTG No data
Right 1069049643 10:63778961-63778983 AAAACTGTCTTCCACAAAACTGG 0: 98
1: 406
2: 706
3: 913
4: 929
1069049638_1069049644 0 Left 1069049638 10:63778945-63778967 CCCACCCCATTATGGAAAAACTG No data
Right 1069049644 10:63778968-63778990 TCTTCCACAAAACTGGTCTCTGG 0: 16
1: 249
2: 558
3: 1169
4: 1339
1069049638_1069049646 11 Left 1069049638 10:63778945-63778967 CCCACCCCATTATGGAAAAACTG No data
Right 1069049646 10:63778979-63779001 ACTGGTCTCTGGTGCCAAAAAGG 0: 39
1: 472
2: 900
3: 1308
4: 1244
1069049638_1069049648 16 Left 1069049638 10:63778945-63778967 CCCACCCCATTATGGAAAAACTG No data
Right 1069049648 10:63778984-63779006 TCTCTGGTGCCAAAAAGGTTGGG 0: 78
1: 1103
2: 1667
3: 1354
4: 955
1069049638_1069049651 28 Left 1069049638 10:63778945-63778967 CCCACCCCATTATGGAAAAACTG No data
Right 1069049651 10:63778996-63779018 AAAAGGTTGGGGATTCTTGCTGG No data
1069049638_1069049649 17 Left 1069049638 10:63778945-63778967 CCCACCCCATTATGGAAAAACTG No data
Right 1069049649 10:63778985-63779007 CTCTGGTGCCAAAAAGGTTGGGG 0: 69
1: 1092
2: 1638
3: 1270
4: 987
1069049638_1069049647 15 Left 1069049638 10:63778945-63778967 CCCACCCCATTATGGAAAAACTG No data
Right 1069049647 10:63778983-63779005 GTCTCTGGTGCCAAAAAGGTTGG 0: 72
1: 1078
2: 1756
3: 1387
4: 967
1069049638_1069049653 30 Left 1069049638 10:63778945-63778967 CCCACCCCATTATGGAAAAACTG No data
Right 1069049653 10:63778998-63779020 AAGGTTGGGGATTCTTGCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069049638 Original CRISPR CAGTTTTTCCATAATGGGGT GGG (reversed) Intergenic
No off target data available for this crispr