ID: 1069049643

View in Genome Browser
Species Human (GRCh38)
Location 10:63778961-63778983
Sequence AAAACTGTCTTCCACAAAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 3052
Summary {0: 98, 1: 406, 2: 706, 3: 913, 4: 929}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069049637_1069049643 -6 Left 1069049637 10:63778944-63778966 CCCCACCCCATTATGGAAAAACT No data
Right 1069049643 10:63778961-63778983 AAAACTGTCTTCCACAAAACTGG 0: 98
1: 406
2: 706
3: 913
4: 929
1069049631_1069049643 9 Left 1069049631 10:63778929-63778951 CCAAAGCCATCCCACCCCCACCC No data
Right 1069049643 10:63778961-63778983 AAAACTGTCTTCCACAAAACTGG 0: 98
1: 406
2: 706
3: 913
4: 929
1069049638_1069049643 -7 Left 1069049638 10:63778945-63778967 CCCACCCCATTATGGAAAAACTG No data
Right 1069049643 10:63778961-63778983 AAAACTGTCTTCCACAAAACTGG 0: 98
1: 406
2: 706
3: 913
4: 929
1069049630_1069049643 10 Left 1069049630 10:63778928-63778950 CCCAAAGCCATCCCACCCCCACC No data
Right 1069049643 10:63778961-63778983 AAAACTGTCTTCCACAAAACTGG 0: 98
1: 406
2: 706
3: 913
4: 929
1069049636_1069049643 -5 Left 1069049636 10:63778943-63778965 CCCCCACCCCATTATGGAAAAAC No data
Right 1069049643 10:63778961-63778983 AAAACTGTCTTCCACAAAACTGG 0: 98
1: 406
2: 706
3: 913
4: 929
1069049632_1069049643 3 Left 1069049632 10:63778935-63778957 CCATCCCACCCCCACCCCATTAT No data
Right 1069049643 10:63778961-63778983 AAAACTGTCTTCCACAAAACTGG 0: 98
1: 406
2: 706
3: 913
4: 929
1069049635_1069049643 -2 Left 1069049635 10:63778940-63778962 CCACCCCCACCCCATTATGGAAA No data
Right 1069049643 10:63778961-63778983 AAAACTGTCTTCCACAAAACTGG 0: 98
1: 406
2: 706
3: 913
4: 929
1069049639_1069049643 -8 Left 1069049639 10:63778946-63778968 CCACCCCATTATGGAAAAACTGT No data
Right 1069049643 10:63778961-63778983 AAAACTGTCTTCCACAAAACTGG 0: 98
1: 406
2: 706
3: 913
4: 929
1069049634_1069049643 -1 Left 1069049634 10:63778939-63778961 CCCACCCCCACCCCATTATGGAA No data
Right 1069049643 10:63778961-63778983 AAAACTGTCTTCCACAAAACTGG 0: 98
1: 406
2: 706
3: 913
4: 929

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069049643 Original CRISPR AAAACTGTCTTCCACAAAAC TGG Intergenic
Too many off-targets to display for this crispr