ID: 1069049645

View in Genome Browser
Species Human (GRCh38)
Location 10:63778972-63778994
Sequence GGCACCAGAGACCAGTTTTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 3434
Summary {0: 12, 1: 235, 2: 535, 3: 1188, 4: 1464}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069049645_1069049653 3 Left 1069049645 10:63778972-63778994 CCACAAAACTGGTCTCTGGTGCC 0: 12
1: 235
2: 535
3: 1188
4: 1464
Right 1069049653 10:63778998-63779020 AAGGTTGGGGATTCTTGCTGGGG No data
1069049645_1069049655 25 Left 1069049645 10:63778972-63778994 CCACAAAACTGGTCTCTGGTGCC 0: 12
1: 235
2: 535
3: 1188
4: 1464
Right 1069049655 10:63779020-63779042 GTAGCCCAGCCTTTGAGGTGAGG No data
1069049645_1069049652 2 Left 1069049645 10:63778972-63778994 CCACAAAACTGGTCTCTGGTGCC 0: 12
1: 235
2: 535
3: 1188
4: 1464
Right 1069049652 10:63778997-63779019 AAAGGTTGGGGATTCTTGCTGGG No data
1069049645_1069049649 -10 Left 1069049645 10:63778972-63778994 CCACAAAACTGGTCTCTGGTGCC 0: 12
1: 235
2: 535
3: 1188
4: 1464
Right 1069049649 10:63778985-63779007 CTCTGGTGCCAAAAAGGTTGGGG 0: 69
1: 1092
2: 1638
3: 1270
4: 987
1069049645_1069049654 20 Left 1069049645 10:63778972-63778994 CCACAAAACTGGTCTCTGGTGCC 0: 12
1: 235
2: 535
3: 1188
4: 1464
Right 1069049654 10:63779015-63779037 CTGGGGTAGCCCAGCCTTTGAGG No data
1069049645_1069049651 1 Left 1069049645 10:63778972-63778994 CCACAAAACTGGTCTCTGGTGCC 0: 12
1: 235
2: 535
3: 1188
4: 1464
Right 1069049651 10:63778996-63779018 AAAAGGTTGGGGATTCTTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069049645 Original CRISPR GGCACCAGAGACCAGTTTTG TGG (reversed) Intergenic
Too many off-targets to display for this crispr