ID: 1069049646

View in Genome Browser
Species Human (GRCh38)
Location 10:63778979-63779001
Sequence ACTGGTCTCTGGTGCCAAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 3963
Summary {0: 39, 1: 472, 2: 900, 3: 1308, 4: 1244}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069049636_1069049646 13 Left 1069049636 10:63778943-63778965 CCCCCACCCCATTATGGAAAAAC No data
Right 1069049646 10:63778979-63779001 ACTGGTCTCTGGTGCCAAAAAGG 0: 39
1: 472
2: 900
3: 1308
4: 1244
1069049641_1069049646 6 Left 1069049641 10:63778950-63778972 CCCATTATGGAAAAACTGTCTTC No data
Right 1069049646 10:63778979-63779001 ACTGGTCTCTGGTGCCAAAAAGG 0: 39
1: 472
2: 900
3: 1308
4: 1244
1069049635_1069049646 16 Left 1069049635 10:63778940-63778962 CCACCCCCACCCCATTATGGAAA No data
Right 1069049646 10:63778979-63779001 ACTGGTCTCTGGTGCCAAAAAGG 0: 39
1: 472
2: 900
3: 1308
4: 1244
1069049630_1069049646 28 Left 1069049630 10:63778928-63778950 CCCAAAGCCATCCCACCCCCACC No data
Right 1069049646 10:63778979-63779001 ACTGGTCTCTGGTGCCAAAAAGG 0: 39
1: 472
2: 900
3: 1308
4: 1244
1069049631_1069049646 27 Left 1069049631 10:63778929-63778951 CCAAAGCCATCCCACCCCCACCC No data
Right 1069049646 10:63778979-63779001 ACTGGTCTCTGGTGCCAAAAAGG 0: 39
1: 472
2: 900
3: 1308
4: 1244
1069049632_1069049646 21 Left 1069049632 10:63778935-63778957 CCATCCCACCCCCACCCCATTAT No data
Right 1069049646 10:63778979-63779001 ACTGGTCTCTGGTGCCAAAAAGG 0: 39
1: 472
2: 900
3: 1308
4: 1244
1069049642_1069049646 5 Left 1069049642 10:63778951-63778973 CCATTATGGAAAAACTGTCTTCC No data
Right 1069049646 10:63778979-63779001 ACTGGTCTCTGGTGCCAAAAAGG 0: 39
1: 472
2: 900
3: 1308
4: 1244
1069049638_1069049646 11 Left 1069049638 10:63778945-63778967 CCCACCCCATTATGGAAAAACTG No data
Right 1069049646 10:63778979-63779001 ACTGGTCTCTGGTGCCAAAAAGG 0: 39
1: 472
2: 900
3: 1308
4: 1244
1069049639_1069049646 10 Left 1069049639 10:63778946-63778968 CCACCCCATTATGGAAAAACTGT No data
Right 1069049646 10:63778979-63779001 ACTGGTCTCTGGTGCCAAAAAGG 0: 39
1: 472
2: 900
3: 1308
4: 1244
1069049640_1069049646 7 Left 1069049640 10:63778949-63778971 CCCCATTATGGAAAAACTGTCTT No data
Right 1069049646 10:63778979-63779001 ACTGGTCTCTGGTGCCAAAAAGG 0: 39
1: 472
2: 900
3: 1308
4: 1244
1069049637_1069049646 12 Left 1069049637 10:63778944-63778966 CCCCACCCCATTATGGAAAAACT No data
Right 1069049646 10:63778979-63779001 ACTGGTCTCTGGTGCCAAAAAGG 0: 39
1: 472
2: 900
3: 1308
4: 1244
1069049634_1069049646 17 Left 1069049634 10:63778939-63778961 CCCACCCCCACCCCATTATGGAA No data
Right 1069049646 10:63778979-63779001 ACTGGTCTCTGGTGCCAAAAAGG 0: 39
1: 472
2: 900
3: 1308
4: 1244

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069049646 Original CRISPR ACTGGTCTCTGGTGCCAAAA AGG Intergenic
Too many off-targets to display for this crispr