ID: 1069049647

View in Genome Browser
Species Human (GRCh38)
Location 10:63778983-63779005
Sequence GTCTCTGGTGCCAAAAAGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 5260
Summary {0: 72, 1: 1078, 2: 1756, 3: 1387, 4: 967}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069049640_1069049647 11 Left 1069049640 10:63778949-63778971 CCCCATTATGGAAAAACTGTCTT No data
Right 1069049647 10:63778983-63779005 GTCTCTGGTGCCAAAAAGGTTGG 0: 72
1: 1078
2: 1756
3: 1387
4: 967
1069049634_1069049647 21 Left 1069049634 10:63778939-63778961 CCCACCCCCACCCCATTATGGAA No data
Right 1069049647 10:63778983-63779005 GTCTCTGGTGCCAAAAAGGTTGG 0: 72
1: 1078
2: 1756
3: 1387
4: 967
1069049639_1069049647 14 Left 1069049639 10:63778946-63778968 CCACCCCATTATGGAAAAACTGT No data
Right 1069049647 10:63778983-63779005 GTCTCTGGTGCCAAAAAGGTTGG 0: 72
1: 1078
2: 1756
3: 1387
4: 967
1069049641_1069049647 10 Left 1069049641 10:63778950-63778972 CCCATTATGGAAAAACTGTCTTC No data
Right 1069049647 10:63778983-63779005 GTCTCTGGTGCCAAAAAGGTTGG 0: 72
1: 1078
2: 1756
3: 1387
4: 967
1069049632_1069049647 25 Left 1069049632 10:63778935-63778957 CCATCCCACCCCCACCCCATTAT No data
Right 1069049647 10:63778983-63779005 GTCTCTGGTGCCAAAAAGGTTGG 0: 72
1: 1078
2: 1756
3: 1387
4: 967
1069049637_1069049647 16 Left 1069049637 10:63778944-63778966 CCCCACCCCATTATGGAAAAACT No data
Right 1069049647 10:63778983-63779005 GTCTCTGGTGCCAAAAAGGTTGG 0: 72
1: 1078
2: 1756
3: 1387
4: 967
1069049636_1069049647 17 Left 1069049636 10:63778943-63778965 CCCCCACCCCATTATGGAAAAAC No data
Right 1069049647 10:63778983-63779005 GTCTCTGGTGCCAAAAAGGTTGG 0: 72
1: 1078
2: 1756
3: 1387
4: 967
1069049638_1069049647 15 Left 1069049638 10:63778945-63778967 CCCACCCCATTATGGAAAAACTG No data
Right 1069049647 10:63778983-63779005 GTCTCTGGTGCCAAAAAGGTTGG 0: 72
1: 1078
2: 1756
3: 1387
4: 967
1069049642_1069049647 9 Left 1069049642 10:63778951-63778973 CCATTATGGAAAAACTGTCTTCC No data
Right 1069049647 10:63778983-63779005 GTCTCTGGTGCCAAAAAGGTTGG 0: 72
1: 1078
2: 1756
3: 1387
4: 967
1069049635_1069049647 20 Left 1069049635 10:63778940-63778962 CCACCCCCACCCCATTATGGAAA No data
Right 1069049647 10:63778983-63779005 GTCTCTGGTGCCAAAAAGGTTGG 0: 72
1: 1078
2: 1756
3: 1387
4: 967

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069049647 Original CRISPR GTCTCTGGTGCCAAAAAGGT TGG Intergenic
Too many off-targets to display for this crispr