ID: 1069049649

View in Genome Browser
Species Human (GRCh38)
Location 10:63778985-63779007
Sequence CTCTGGTGCCAAAAAGGTTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 5056
Summary {0: 69, 1: 1092, 2: 1638, 3: 1270, 4: 987}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069049637_1069049649 18 Left 1069049637 10:63778944-63778966 CCCCACCCCATTATGGAAAAACT No data
Right 1069049649 10:63778985-63779007 CTCTGGTGCCAAAAAGGTTGGGG 0: 69
1: 1092
2: 1638
3: 1270
4: 987
1069049641_1069049649 12 Left 1069049641 10:63778950-63778972 CCCATTATGGAAAAACTGTCTTC No data
Right 1069049649 10:63778985-63779007 CTCTGGTGCCAAAAAGGTTGGGG 0: 69
1: 1092
2: 1638
3: 1270
4: 987
1069049639_1069049649 16 Left 1069049639 10:63778946-63778968 CCACCCCATTATGGAAAAACTGT No data
Right 1069049649 10:63778985-63779007 CTCTGGTGCCAAAAAGGTTGGGG 0: 69
1: 1092
2: 1638
3: 1270
4: 987
1069049635_1069049649 22 Left 1069049635 10:63778940-63778962 CCACCCCCACCCCATTATGGAAA No data
Right 1069049649 10:63778985-63779007 CTCTGGTGCCAAAAAGGTTGGGG 0: 69
1: 1092
2: 1638
3: 1270
4: 987
1069049634_1069049649 23 Left 1069049634 10:63778939-63778961 CCCACCCCCACCCCATTATGGAA No data
Right 1069049649 10:63778985-63779007 CTCTGGTGCCAAAAAGGTTGGGG 0: 69
1: 1092
2: 1638
3: 1270
4: 987
1069049642_1069049649 11 Left 1069049642 10:63778951-63778973 CCATTATGGAAAAACTGTCTTCC No data
Right 1069049649 10:63778985-63779007 CTCTGGTGCCAAAAAGGTTGGGG 0: 69
1: 1092
2: 1638
3: 1270
4: 987
1069049636_1069049649 19 Left 1069049636 10:63778943-63778965 CCCCCACCCCATTATGGAAAAAC No data
Right 1069049649 10:63778985-63779007 CTCTGGTGCCAAAAAGGTTGGGG 0: 69
1: 1092
2: 1638
3: 1270
4: 987
1069049638_1069049649 17 Left 1069049638 10:63778945-63778967 CCCACCCCATTATGGAAAAACTG No data
Right 1069049649 10:63778985-63779007 CTCTGGTGCCAAAAAGGTTGGGG 0: 69
1: 1092
2: 1638
3: 1270
4: 987
1069049640_1069049649 13 Left 1069049640 10:63778949-63778971 CCCCATTATGGAAAAACTGTCTT No data
Right 1069049649 10:63778985-63779007 CTCTGGTGCCAAAAAGGTTGGGG 0: 69
1: 1092
2: 1638
3: 1270
4: 987
1069049645_1069049649 -10 Left 1069049645 10:63778972-63778994 CCACAAAACTGGTCTCTGGTGCC 0: 12
1: 235
2: 535
3: 1188
4: 1464
Right 1069049649 10:63778985-63779007 CTCTGGTGCCAAAAAGGTTGGGG 0: 69
1: 1092
2: 1638
3: 1270
4: 987
1069049632_1069049649 27 Left 1069049632 10:63778935-63778957 CCATCCCACCCCCACCCCATTAT No data
Right 1069049649 10:63778985-63779007 CTCTGGTGCCAAAAAGGTTGGGG 0: 69
1: 1092
2: 1638
3: 1270
4: 987

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069049649 Original CRISPR CTCTGGTGCCAAAAAGGTTG GGG Intergenic
Too many off-targets to display for this crispr