ID: 1069049651

View in Genome Browser
Species Human (GRCh38)
Location 10:63778996-63779018
Sequence AAAAGGTTGGGGATTCTTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069049645_1069049651 1 Left 1069049645 10:63778972-63778994 CCACAAAACTGGTCTCTGGTGCC 0: 12
1: 235
2: 535
3: 1188
4: 1464
Right 1069049651 10:63778996-63779018 AAAAGGTTGGGGATTCTTGCTGG No data
1069049638_1069049651 28 Left 1069049638 10:63778945-63778967 CCCACCCCATTATGGAAAAACTG No data
Right 1069049651 10:63778996-63779018 AAAAGGTTGGGGATTCTTGCTGG No data
1069049636_1069049651 30 Left 1069049636 10:63778943-63778965 CCCCCACCCCATTATGGAAAAAC No data
Right 1069049651 10:63778996-63779018 AAAAGGTTGGGGATTCTTGCTGG No data
1069049639_1069049651 27 Left 1069049639 10:63778946-63778968 CCACCCCATTATGGAAAAACTGT No data
Right 1069049651 10:63778996-63779018 AAAAGGTTGGGGATTCTTGCTGG No data
1069049641_1069049651 23 Left 1069049641 10:63778950-63778972 CCCATTATGGAAAAACTGTCTTC No data
Right 1069049651 10:63778996-63779018 AAAAGGTTGGGGATTCTTGCTGG No data
1069049642_1069049651 22 Left 1069049642 10:63778951-63778973 CCATTATGGAAAAACTGTCTTCC No data
Right 1069049651 10:63778996-63779018 AAAAGGTTGGGGATTCTTGCTGG No data
1069049640_1069049651 24 Left 1069049640 10:63778949-63778971 CCCCATTATGGAAAAACTGTCTT No data
Right 1069049651 10:63778996-63779018 AAAAGGTTGGGGATTCTTGCTGG No data
1069049637_1069049651 29 Left 1069049637 10:63778944-63778966 CCCCACCCCATTATGGAAAAACT No data
Right 1069049651 10:63778996-63779018 AAAAGGTTGGGGATTCTTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069049651 Original CRISPR AAAAGGTTGGGGATTCTTGC TGG Intergenic
No off target data available for this crispr