ID: 1069050571

View in Genome Browser
Species Human (GRCh38)
Location 10:63788305-63788327
Sequence AGGGAGAGCACAGTGACTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069050560_1069050571 20 Left 1069050560 10:63788262-63788284 CCCCTAGCAGAGGCCATGTGGTG No data
Right 1069050571 10:63788305-63788327 AGGGAGAGCACAGTGACTGGGGG No data
1069050561_1069050571 19 Left 1069050561 10:63788263-63788285 CCCTAGCAGAGGCCATGTGGTGC No data
Right 1069050571 10:63788305-63788327 AGGGAGAGCACAGTGACTGGGGG No data
1069050563_1069050571 7 Left 1069050563 10:63788275-63788297 CCATGTGGTGCAGAGAGCCTGTG No data
Right 1069050571 10:63788305-63788327 AGGGAGAGCACAGTGACTGGGGG No data
1069050567_1069050571 -10 Left 1069050567 10:63788292-63788314 CCTGTGCACTCGGAGGGAGAGCA No data
Right 1069050571 10:63788305-63788327 AGGGAGAGCACAGTGACTGGGGG No data
1069050558_1069050571 25 Left 1069050558 10:63788257-63788279 CCTGTCCCCTAGCAGAGGCCATG No data
Right 1069050571 10:63788305-63788327 AGGGAGAGCACAGTGACTGGGGG No data
1069050556_1069050571 27 Left 1069050556 10:63788255-63788277 CCCCTGTCCCCTAGCAGAGGCCA No data
Right 1069050571 10:63788305-63788327 AGGGAGAGCACAGTGACTGGGGG No data
1069050557_1069050571 26 Left 1069050557 10:63788256-63788278 CCCTGTCCCCTAGCAGAGGCCAT No data
Right 1069050571 10:63788305-63788327 AGGGAGAGCACAGTGACTGGGGG No data
1069050562_1069050571 18 Left 1069050562 10:63788264-63788286 CCTAGCAGAGGCCATGTGGTGCA No data
Right 1069050571 10:63788305-63788327 AGGGAGAGCACAGTGACTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069050571 Original CRISPR AGGGAGAGCACAGTGACTGG GGG Intergenic