ID: 1069053767

View in Genome Browser
Species Human (GRCh38)
Location 10:63822284-63822306
Sequence GATGTTGATTGGCCTAGTTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069053767_1069053771 3 Left 1069053767 10:63822284-63822306 CCCAAACTAGGCCAATCAACATC No data
Right 1069053771 10:63822310-63822332 TTTTGGAAGTTTGAAACTTTAGG No data
1069053767_1069053772 4 Left 1069053767 10:63822284-63822306 CCCAAACTAGGCCAATCAACATC No data
Right 1069053772 10:63822311-63822333 TTTGGAAGTTTGAAACTTTAGGG No data
1069053767_1069053773 30 Left 1069053767 10:63822284-63822306 CCCAAACTAGGCCAATCAACATC No data
Right 1069053773 10:63822337-63822359 ATCCTCAGCTAGAAGATGTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069053767 Original CRISPR GATGTTGATTGGCCTAGTTT GGG (reversed) Intergenic
No off target data available for this crispr