ID: 1069053770

View in Genome Browser
Species Human (GRCh38)
Location 10:63822295-63822317
Sequence TTCCAAAAGACGATGTTGAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069053770_1069053771 -8 Left 1069053770 10:63822295-63822317 CCAATCAACATCGTCTTTTGGAA No data
Right 1069053771 10:63822310-63822332 TTTTGGAAGTTTGAAACTTTAGG No data
1069053770_1069053772 -7 Left 1069053770 10:63822295-63822317 CCAATCAACATCGTCTTTTGGAA No data
Right 1069053772 10:63822311-63822333 TTTGGAAGTTTGAAACTTTAGGG No data
1069053770_1069053775 24 Left 1069053770 10:63822295-63822317 CCAATCAACATCGTCTTTTGGAA No data
Right 1069053775 10:63822342-63822364 CAGCTAGAAGATGTATGGAGTGG No data
1069053770_1069053773 19 Left 1069053770 10:63822295-63822317 CCAATCAACATCGTCTTTTGGAA No data
Right 1069053773 10:63822337-63822359 ATCCTCAGCTAGAAGATGTATGG No data
1069053770_1069053776 25 Left 1069053770 10:63822295-63822317 CCAATCAACATCGTCTTTTGGAA No data
Right 1069053776 10:63822343-63822365 AGCTAGAAGATGTATGGAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069053770 Original CRISPR TTCCAAAAGACGATGTTGAT TGG (reversed) Intergenic
No off target data available for this crispr