ID: 1069053773

View in Genome Browser
Species Human (GRCh38)
Location 10:63822337-63822359
Sequence ATCCTCAGCTAGAAGATGTA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069053770_1069053773 19 Left 1069053770 10:63822295-63822317 CCAATCAACATCGTCTTTTGGAA No data
Right 1069053773 10:63822337-63822359 ATCCTCAGCTAGAAGATGTATGG No data
1069053767_1069053773 30 Left 1069053767 10:63822284-63822306 CCCAAACTAGGCCAATCAACATC No data
Right 1069053773 10:63822337-63822359 ATCCTCAGCTAGAAGATGTATGG No data
1069053768_1069053773 29 Left 1069053768 10:63822285-63822307 CCAAACTAGGCCAATCAACATCG No data
Right 1069053773 10:63822337-63822359 ATCCTCAGCTAGAAGATGTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069053773 Original CRISPR ATCCTCAGCTAGAAGATGTA TGG Intergenic
No off target data available for this crispr