ID: 1069060300

View in Genome Browser
Species Human (GRCh38)
Location 10:63887852-63887874
Sequence AAGTGTACAGACTCTGTTTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069060298_1069060300 18 Left 1069060298 10:63887811-63887833 CCGGAAGTAGGGAGTACTGACAA No data
Right 1069060300 10:63887852-63887874 AAGTGTACAGACTCTGTTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069060300 Original CRISPR AAGTGTACAGACTCTGTTTC TGG Intergenic
No off target data available for this crispr