ID: 1069066467

View in Genome Browser
Species Human (GRCh38)
Location 10:63947122-63947144
Sequence GACTGCCAGACTTTGGTATC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069066464_1069066467 29 Left 1069066464 10:63947070-63947092 CCATCGATGTTCATCAGGGATAT 0: 22
1: 74
2: 129
3: 96
4: 197
Right 1069066467 10:63947122-63947144 GACTGCCAGACTTTGGTATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069066467 Original CRISPR GACTGCCAGACTTTGGTATC AGG Intergenic
No off target data available for this crispr