ID: 1069068539

View in Genome Browser
Species Human (GRCh38)
Location 10:63971767-63971789
Sequence ATTACCAGTTTTATTTTGTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069068539_1069068540 5 Left 1069068539 10:63971767-63971789 CCAAACAAAATAAAACTGGTAAT No data
Right 1069068540 10:63971795-63971817 GCAAGACTGATCTTCCTATTTGG No data
1069068539_1069068541 17 Left 1069068539 10:63971767-63971789 CCAAACAAAATAAAACTGGTAAT No data
Right 1069068541 10:63971807-63971829 TTCCTATTTGGAATGACAAGAGG No data
1069068539_1069068542 18 Left 1069068539 10:63971767-63971789 CCAAACAAAATAAAACTGGTAAT No data
Right 1069068542 10:63971808-63971830 TCCTATTTGGAATGACAAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069068539 Original CRISPR ATTACCAGTTTTATTTTGTT TGG (reversed) Intergenic
No off target data available for this crispr