ID: 1069068924

View in Genome Browser
Species Human (GRCh38)
Location 10:63974426-63974448
Sequence TGATGTTGGAGGAGACTAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069068920_1069068924 0 Left 1069068920 10:63974403-63974425 CCGTCGGAGAGCTCTCCACTCAC No data
Right 1069068924 10:63974426-63974448 TGATGTTGGAGGAGACTAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069068924 Original CRISPR TGATGTTGGAGGAGACTAGC AGG Intergenic
No off target data available for this crispr