ID: 1069071988

View in Genome Browser
Species Human (GRCh38)
Location 10:63998641-63998663
Sequence CAGACTGCACTCCCATGCAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069071988_1069071996 12 Left 1069071988 10:63998641-63998663 CCAATGCATGGGAGTGCAGTCTG No data
Right 1069071996 10:63998676-63998698 CTACTAATTGCTATTGCAGATGG No data
1069071988_1069071997 24 Left 1069071988 10:63998641-63998663 CCAATGCATGGGAGTGCAGTCTG No data
Right 1069071997 10:63998688-63998710 ATTGCAGATGGAGCCTTTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069071988 Original CRISPR CAGACTGCACTCCCATGCAT TGG (reversed) Intergenic
No off target data available for this crispr