ID: 1069072667

View in Genome Browser
Species Human (GRCh38)
Location 10:64005733-64005755
Sequence GTGGCTGCATTCTCCCTGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069072667_1069072671 1 Left 1069072667 10:64005733-64005755 CCTTGCAGGGAGAATGCAGCCAC No data
Right 1069072671 10:64005757-64005779 AGAGAGGTCCCAGACCTCTAAGG No data
1069072667_1069072672 2 Left 1069072667 10:64005733-64005755 CCTTGCAGGGAGAATGCAGCCAC No data
Right 1069072672 10:64005758-64005780 GAGAGGTCCCAGACCTCTAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069072667 Original CRISPR GTGGCTGCATTCTCCCTGCA AGG (reversed) Intergenic
No off target data available for this crispr