ID: 1069072672

View in Genome Browser
Species Human (GRCh38)
Location 10:64005758-64005780
Sequence GAGAGGTCCCAGACCTCTAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069072666_1069072672 12 Left 1069072666 10:64005723-64005745 CCTGTGCTGACCTTGCAGGGAGA No data
Right 1069072672 10:64005758-64005780 GAGAGGTCCCAGACCTCTAAGGG No data
1069072667_1069072672 2 Left 1069072667 10:64005733-64005755 CCTTGCAGGGAGAATGCAGCCAC No data
Right 1069072672 10:64005758-64005780 GAGAGGTCCCAGACCTCTAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069072672 Original CRISPR GAGAGGTCCCAGACCTCTAA GGG Intergenic
No off target data available for this crispr