ID: 1069072910

View in Genome Browser
Species Human (GRCh38)
Location 10:64008091-64008113
Sequence ATATTCCCCAAGAAGAACCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069072906_1069072910 27 Left 1069072906 10:64008041-64008063 CCTAGGTTTTCTTCTAAGATTTT 0: 41
1: 1257
2: 16506
3: 8582
4: 7777
Right 1069072910 10:64008091-64008113 ATATTCCCCAAGAAGAACCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069072910 Original CRISPR ATATTCCCCAAGAAGAACCA GGG Intergenic
No off target data available for this crispr