ID: 1069080518

View in Genome Browser
Species Human (GRCh38)
Location 10:64083651-64083673
Sequence TGAAGTAGCTGCATTTGTAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069080518_1069080523 16 Left 1069080518 10:64083651-64083673 CCCCTACAAATGCAGCTACTTCA No data
Right 1069080523 10:64083690-64083712 GTTAGAGACCTCCAAGTTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069080518 Original CRISPR TGAAGTAGCTGCATTTGTAG GGG (reversed) Intergenic
No off target data available for this crispr