ID: 1069088978

View in Genome Browser
Species Human (GRCh38)
Location 10:64176431-64176453
Sequence ATTTGAGTCAGTAAGGGAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069088978_1069088983 21 Left 1069088978 10:64176431-64176453 CCATCTCCCTTACTGACTCAAAT No data
Right 1069088983 10:64176475-64176497 TTTAAGTACATGTAGGAAAATGG No data
1069088978_1069088986 30 Left 1069088978 10:64176431-64176453 CCATCTCCCTTACTGACTCAAAT No data
Right 1069088986 10:64176484-64176506 ATGTAGGAAAATGGGAACTAGGG No data
1069088978_1069088982 14 Left 1069088978 10:64176431-64176453 CCATCTCCCTTACTGACTCAAAT No data
Right 1069088982 10:64176468-64176490 ACAGAAATTTAAGTACATGTAGG No data
1069088978_1069088984 22 Left 1069088978 10:64176431-64176453 CCATCTCCCTTACTGACTCAAAT No data
Right 1069088984 10:64176476-64176498 TTAAGTACATGTAGGAAAATGGG No data
1069088978_1069088985 29 Left 1069088978 10:64176431-64176453 CCATCTCCCTTACTGACTCAAAT No data
Right 1069088985 10:64176483-64176505 CATGTAGGAAAATGGGAACTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069088978 Original CRISPR ATTTGAGTCAGTAAGGGAGA TGG (reversed) Intergenic
No off target data available for this crispr