ID: 1069094716

View in Genome Browser
Species Human (GRCh38)
Location 10:64244645-64244667
Sequence ATCTATAAGAAAATGCAGGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069094716_1069094721 21 Left 1069094716 10:64244645-64244667 CCGGCCTGCATTTTCTTATAGAT No data
Right 1069094721 10:64244689-64244711 TTTATAAAAATTACTTGTTGGGG No data
1069094716_1069094719 19 Left 1069094716 10:64244645-64244667 CCGGCCTGCATTTTCTTATAGAT No data
Right 1069094719 10:64244687-64244709 TTTTTATAAAAATTACTTGTTGG No data
1069094716_1069094720 20 Left 1069094716 10:64244645-64244667 CCGGCCTGCATTTTCTTATAGAT No data
Right 1069094720 10:64244688-64244710 TTTTATAAAAATTACTTGTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069094716 Original CRISPR ATCTATAAGAAAATGCAGGC CGG (reversed) Intergenic
No off target data available for this crispr