ID: 1069103360

View in Genome Browser
Species Human (GRCh38)
Location 10:64351842-64351864
Sequence TGAAACCAGAGCTCAACCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069103358_1069103360 -2 Left 1069103358 10:64351821-64351843 CCTGGGACACTAACCATATTGTG No data
Right 1069103360 10:64351842-64351864 TGAAACCAGAGCTCAACCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069103360 Original CRISPR TGAAACCAGAGCTCAACCCC TGG Intergenic
No off target data available for this crispr