ID: 1069106111

View in Genome Browser
Species Human (GRCh38)
Location 10:64385089-64385111
Sequence ACCTCCTCCAGACCCCAGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069106111_1069106119 23 Left 1069106111 10:64385089-64385111 CCATTCTGGGGTCTGGAGGAGGT No data
Right 1069106119 10:64385135-64385157 CACTAGGCAGTGCTCCAGTGGGG No data
1069106111_1069106120 24 Left 1069106111 10:64385089-64385111 CCATTCTGGGGTCTGGAGGAGGT No data
Right 1069106120 10:64385136-64385158 ACTAGGCAGTGCTCCAGTGGGGG No data
1069106111_1069106115 7 Left 1069106111 10:64385089-64385111 CCATTCTGGGGTCTGGAGGAGGT No data
Right 1069106115 10:64385119-64385141 CTTCTTCTCATAGCTCCACTAGG No data
1069106111_1069106116 21 Left 1069106111 10:64385089-64385111 CCATTCTGGGGTCTGGAGGAGGT No data
Right 1069106116 10:64385133-64385155 TCCACTAGGCAGTGCTCCAGTGG No data
1069106111_1069106118 22 Left 1069106111 10:64385089-64385111 CCATTCTGGGGTCTGGAGGAGGT No data
Right 1069106118 10:64385134-64385156 CCACTAGGCAGTGCTCCAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069106111 Original CRISPR ACCTCCTCCAGACCCCAGAA TGG (reversed) Intergenic