ID: 1069106111

View in Genome Browser
Species Human (GRCh38)
Location 10:64385089-64385111
Sequence ACCTCCTCCAGACCCCAGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069106111_1069106118 22 Left 1069106111 10:64385089-64385111 CCATTCTGGGGTCTGGAGGAGGT No data
Right 1069106118 10:64385134-64385156 CCACTAGGCAGTGCTCCAGTGGG 0: 81
1: 1100
2: 1690
3: 1605
4: 1253
1069106111_1069106120 24 Left 1069106111 10:64385089-64385111 CCATTCTGGGGTCTGGAGGAGGT No data
Right 1069106120 10:64385136-64385158 ACTAGGCAGTGCTCCAGTGGGGG No data
1069106111_1069106115 7 Left 1069106111 10:64385089-64385111 CCATTCTGGGGTCTGGAGGAGGT No data
Right 1069106115 10:64385119-64385141 CTTCTTCTCATAGCTCCACTAGG 0: 19
1: 330
2: 2133
3: 2140
4: 1492
1069106111_1069106119 23 Left 1069106111 10:64385089-64385111 CCATTCTGGGGTCTGGAGGAGGT No data
Right 1069106119 10:64385135-64385157 CACTAGGCAGTGCTCCAGTGGGG 0: 53
1: 763
2: 1493
3: 1564
4: 1389
1069106111_1069106116 21 Left 1069106111 10:64385089-64385111 CCATTCTGGGGTCTGGAGGAGGT No data
Right 1069106116 10:64385133-64385155 TCCACTAGGCAGTGCTCCAGTGG 0: 62
1: 788
2: 1243
3: 1044
4: 926

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069106111 Original CRISPR ACCTCCTCCAGACCCCAGAA TGG (reversed) Intergenic
No off target data available for this crispr