ID: 1069106114

View in Genome Browser
Species Human (GRCh38)
Location 10:64385118-64385140
Sequence CTAGTGGAGCTATGAGAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 6232
Summary {0: 165, 1: 1953, 2: 2073, 3: 1213, 4: 828}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069106114_1069106116 -8 Left 1069106114 10:64385118-64385140 CCTTCTTCTCATAGCTCCACTAG 0: 165
1: 1953
2: 2073
3: 1213
4: 828
Right 1069106116 10:64385133-64385155 TCCACTAGGCAGTGCTCCAGTGG 0: 62
1: 788
2: 1243
3: 1044
4: 926
1069106114_1069106119 -6 Left 1069106114 10:64385118-64385140 CCTTCTTCTCATAGCTCCACTAG 0: 165
1: 1953
2: 2073
3: 1213
4: 828
Right 1069106119 10:64385135-64385157 CACTAGGCAGTGCTCCAGTGGGG 0: 53
1: 763
2: 1493
3: 1564
4: 1389
1069106114_1069106122 7 Left 1069106114 10:64385118-64385140 CCTTCTTCTCATAGCTCCACTAG 0: 165
1: 1953
2: 2073
3: 1213
4: 828
Right 1069106122 10:64385148-64385170 TCCAGTGGGGGCTCTGTGTTGGG No data
1069106114_1069106124 8 Left 1069106114 10:64385118-64385140 CCTTCTTCTCATAGCTCCACTAG 0: 165
1: 1953
2: 2073
3: 1213
4: 828
Right 1069106124 10:64385149-64385171 CCAGTGGGGGCTCTGTGTTGGGG No data
1069106114_1069106120 -5 Left 1069106114 10:64385118-64385140 CCTTCTTCTCATAGCTCCACTAG 0: 165
1: 1953
2: 2073
3: 1213
4: 828
Right 1069106120 10:64385136-64385158 ACTAGGCAGTGCTCCAGTGGGGG No data
1069106114_1069106121 6 Left 1069106114 10:64385118-64385140 CCTTCTTCTCATAGCTCCACTAG 0: 165
1: 1953
2: 2073
3: 1213
4: 828
Right 1069106121 10:64385147-64385169 CTCCAGTGGGGGCTCTGTGTTGG No data
1069106114_1069106118 -7 Left 1069106114 10:64385118-64385140 CCTTCTTCTCATAGCTCCACTAG 0: 165
1: 1953
2: 2073
3: 1213
4: 828
Right 1069106118 10:64385134-64385156 CCACTAGGCAGTGCTCCAGTGGG 0: 81
1: 1100
2: 1690
3: 1605
4: 1253

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069106114 Original CRISPR CTAGTGGAGCTATGAGAAGA AGG (reversed) Intergenic
Too many off-targets to display for this crispr