ID: 1069106115

View in Genome Browser
Species Human (GRCh38)
Location 10:64385119-64385141
Sequence CTTCTTCTCATAGCTCCACT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069106111_1069106115 7 Left 1069106111 10:64385089-64385111 CCATTCTGGGGTCTGGAGGAGGT No data
Right 1069106115 10:64385119-64385141 CTTCTTCTCATAGCTCCACTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069106115 Original CRISPR CTTCTTCTCATAGCTCCACT AGG Intergenic