ID: 1069106116

View in Genome Browser
Species Human (GRCh38)
Location 10:64385133-64385155
Sequence TCCACTAGGCAGTGCTCCAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069106111_1069106116 21 Left 1069106111 10:64385089-64385111 CCATTCTGGGGTCTGGAGGAGGT No data
Right 1069106116 10:64385133-64385155 TCCACTAGGCAGTGCTCCAGTGG No data
1069106114_1069106116 -8 Left 1069106114 10:64385118-64385140 CCTTCTTCTCATAGCTCCACTAG No data
Right 1069106116 10:64385133-64385155 TCCACTAGGCAGTGCTCCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069106116 Original CRISPR TCCACTAGGCAGTGCTCCAG TGG Intergenic