ID: 1069106117

View in Genome Browser
Species Human (GRCh38)
Location 10:64385134-64385156
Sequence CCCACTGGAGCACTGCCTAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069106117_1069106121 -10 Left 1069106117 10:64385134-64385156 CCACTAGGCAGTGCTCCAGTGGG No data
Right 1069106121 10:64385147-64385169 CTCCAGTGGGGGCTCTGTGTTGG No data
1069106117_1069106124 -8 Left 1069106117 10:64385134-64385156 CCACTAGGCAGTGCTCCAGTGGG No data
Right 1069106124 10:64385149-64385171 CCAGTGGGGGCTCTGTGTTGGGG No data
1069106117_1069106122 -9 Left 1069106117 10:64385134-64385156 CCACTAGGCAGTGCTCCAGTGGG No data
Right 1069106122 10:64385148-64385170 TCCAGTGGGGGCTCTGTGTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069106117 Original CRISPR CCCACTGGAGCACTGCCTAG TGG (reversed) Intergenic