ID: 1069106119

View in Genome Browser
Species Human (GRCh38)
Location 10:64385135-64385157
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069106111_1069106119 23 Left 1069106111 10:64385089-64385111 CCATTCTGGGGTCTGGAGGAGGT No data
Right 1069106119 10:64385135-64385157 CACTAGGCAGTGCTCCAGTGGGG No data
1069106114_1069106119 -6 Left 1069106114 10:64385118-64385140 CCTTCTTCTCATAGCTCCACTAG No data
Right 1069106119 10:64385135-64385157 CACTAGGCAGTGCTCCAGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069106119 Original CRISPR CACTAGGCAGTGCTCCAGTG GGG Intergenic