ID: 1069106120

View in Genome Browser
Species Human (GRCh38)
Location 10:64385136-64385158
Sequence ACTAGGCAGTGCTCCAGTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069106111_1069106120 24 Left 1069106111 10:64385089-64385111 CCATTCTGGGGTCTGGAGGAGGT No data
Right 1069106120 10:64385136-64385158 ACTAGGCAGTGCTCCAGTGGGGG No data
1069106114_1069106120 -5 Left 1069106114 10:64385118-64385140 CCTTCTTCTCATAGCTCCACTAG 0: 165
1: 1953
2: 2073
3: 1213
4: 828
Right 1069106120 10:64385136-64385158 ACTAGGCAGTGCTCCAGTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069106120 Original CRISPR ACTAGGCAGTGCTCCAGTGG GGG Intergenic
No off target data available for this crispr