ID: 1069106121

View in Genome Browser
Species Human (GRCh38)
Location 10:64385147-64385169
Sequence CTCCAGTGGGGGCTCTGTGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069106114_1069106121 6 Left 1069106114 10:64385118-64385140 CCTTCTTCTCATAGCTCCACTAG No data
Right 1069106121 10:64385147-64385169 CTCCAGTGGGGGCTCTGTGTTGG No data
1069106117_1069106121 -10 Left 1069106117 10:64385134-64385156 CCACTAGGCAGTGCTCCAGTGGG No data
Right 1069106121 10:64385147-64385169 CTCCAGTGGGGGCTCTGTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069106121 Original CRISPR CTCCAGTGGGGGCTCTGTGT TGG Intergenic