ID: 1069106122

View in Genome Browser
Species Human (GRCh38)
Location 10:64385148-64385170
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069106114_1069106122 7 Left 1069106114 10:64385118-64385140 CCTTCTTCTCATAGCTCCACTAG No data
Right 1069106122 10:64385148-64385170 TCCAGTGGGGGCTCTGTGTTGGG No data
1069106117_1069106122 -9 Left 1069106117 10:64385134-64385156 CCACTAGGCAGTGCTCCAGTGGG 0: 54
1: 751
2: 1508
3: 1664
4: 1505
Right 1069106122 10:64385148-64385170 TCCAGTGGGGGCTCTGTGTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069106122 Original CRISPR TCCAGTGGGGGCTCTGTGTT GGG Intergenic