ID: 1069106124

View in Genome Browser
Species Human (GRCh38)
Location 10:64385149-64385171
Sequence CCAGTGGGGGCTCTGTGTTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069106114_1069106124 8 Left 1069106114 10:64385118-64385140 CCTTCTTCTCATAGCTCCACTAG No data
Right 1069106124 10:64385149-64385171 CCAGTGGGGGCTCTGTGTTGGGG No data
1069106117_1069106124 -8 Left 1069106117 10:64385134-64385156 CCACTAGGCAGTGCTCCAGTGGG No data
Right 1069106124 10:64385149-64385171 CCAGTGGGGGCTCTGTGTTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069106124 Original CRISPR CCAGTGGGGGCTCTGTGTTG GGG Intergenic