ID: 1069107120

View in Genome Browser
Species Human (GRCh38)
Location 10:64396795-64396817
Sequence CTGCTACTTGTTTTGAATGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069107110_1069107120 28 Left 1069107110 10:64396744-64396766 CCTTCGGTAGAAGATTCGATTTT No data
Right 1069107120 10:64396795-64396817 CTGCTACTTGTTTTGAATGGGGG No data
1069107112_1069107120 -5 Left 1069107112 10:64396777-64396799 CCCTTTGGTGCCCTTATCCTGCT No data
Right 1069107120 10:64396795-64396817 CTGCTACTTGTTTTGAATGGGGG No data
1069107113_1069107120 -6 Left 1069107113 10:64396778-64396800 CCTTTGGTGCCCTTATCCTGCTA No data
Right 1069107120 10:64396795-64396817 CTGCTACTTGTTTTGAATGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069107120 Original CRISPR CTGCTACTTGTTTTGAATGG GGG Intergenic
No off target data available for this crispr