ID: 1069116452

View in Genome Browser
Species Human (GRCh38)
Location 10:64512756-64512778
Sequence GATAATGAGTATAGTGCTAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069116452_1069116454 2 Left 1069116452 10:64512756-64512778 CCAATAGCACTATACTCATTATC No data
Right 1069116454 10:64512781-64512803 CTATTAGGCAAAGCAATACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069116452 Original CRISPR GATAATGAGTATAGTGCTAT TGG (reversed) Intergenic
No off target data available for this crispr