ID: 1069118617

View in Genome Browser
Species Human (GRCh38)
Location 10:64539381-64539403
Sequence GTCTCCCTTCTCTGCAGGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069118617_1069118623 27 Left 1069118617 10:64539381-64539403 CCTACCCTGCAGAGAAGGGAGAC No data
Right 1069118623 10:64539431-64539453 ACCAGAATTACTCCTGCTCTTGG No data
1069118617_1069118620 -7 Left 1069118617 10:64539381-64539403 CCTACCCTGCAGAGAAGGGAGAC No data
Right 1069118620 10:64539397-64539419 GGGAGACAGAGAAACATATATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069118617 Original CRISPR GTCTCCCTTCTCTGCAGGGT AGG (reversed) Intergenic
No off target data available for this crispr