ID: 1069124385

View in Genome Browser
Species Human (GRCh38)
Location 10:64611340-64611362
Sequence AAGAATAAGCATGAGAGGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069124382_1069124385 11 Left 1069124382 10:64611306-64611328 CCTGAATACATATATGACTATAG No data
Right 1069124385 10:64611340-64611362 AAGAATAAGCATGAGAGGGATGG No data
1069124381_1069124385 12 Left 1069124381 10:64611305-64611327 CCCTGAATACATATATGACTATA No data
Right 1069124385 10:64611340-64611362 AAGAATAAGCATGAGAGGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069124385 Original CRISPR AAGAATAAGCATGAGAGGGA TGG Intergenic
No off target data available for this crispr