ID: 1069124792

View in Genome Browser
Species Human (GRCh38)
Location 10:64617101-64617123
Sequence GTAGTTTAGAATCTATTTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069124786_1069124792 -10 Left 1069124786 10:64617088-64617110 CCCCTCCCTTTTTGTAGTTTAGA No data
Right 1069124792 10:64617101-64617123 GTAGTTTAGAATCTATTTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069124792 Original CRISPR GTAGTTTAGAATCTATTTGT GGG Intergenic
No off target data available for this crispr