ID: 1069132644

View in Genome Browser
Species Human (GRCh38)
Location 10:64726266-64726288
Sequence TGTTGCACTTTCCTCATACG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069132644_1069132647 29 Left 1069132644 10:64726266-64726288 CCACGTATGAGGAAAGTGCAACA No data
Right 1069132647 10:64726318-64726340 CAGTTTTTGGATCTGTAGAATGG No data
1069132644_1069132646 16 Left 1069132644 10:64726266-64726288 CCACGTATGAGGAAAGTGCAACA No data
Right 1069132646 10:64726305-64726327 GTTACTTACTACACAGTTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069132644 Original CRISPR TGTTGCACTTTCCTCATACG TGG (reversed) Intergenic