ID: 1069132645

View in Genome Browser
Species Human (GRCh38)
Location 10:64726302-64726324
Sequence AAAACTGTGTAGTAAGTAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069132645_1069132649 22 Left 1069132645 10:64726302-64726324 CCTGTTACTTACTACACAGTTTT No data
Right 1069132649 10:64726347-64726369 CAATAAAACCCTGTCACCCAGGG No data
1069132645_1069132648 21 Left 1069132645 10:64726302-64726324 CCTGTTACTTACTACACAGTTTT No data
Right 1069132648 10:64726346-64726368 ACAATAAAACCCTGTCACCCAGG No data
1069132645_1069132647 -7 Left 1069132645 10:64726302-64726324 CCTGTTACTTACTACACAGTTTT No data
Right 1069132647 10:64726318-64726340 CAGTTTTTGGATCTGTAGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069132645 Original CRISPR AAAACTGTGTAGTAAGTAAC AGG (reversed) Intergenic