ID: 1069137383

View in Genome Browser
Species Human (GRCh38)
Location 10:64782677-64782699
Sequence ACAAGCAAAGAAATCTCCAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069137383_1069137391 7 Left 1069137383 10:64782677-64782699 CCTTTGGAGATTTCTTTGCTTGT No data
Right 1069137391 10:64782707-64782729 TGGGCAGGGGAGATTAGAGGAGG No data
1069137383_1069137388 -6 Left 1069137383 10:64782677-64782699 CCTTTGGAGATTTCTTTGCTTGT No data
Right 1069137388 10:64782694-64782716 GCTTGTTTCCTTCTGGGCAGGGG No data
1069137383_1069137393 26 Left 1069137383 10:64782677-64782699 CCTTTGGAGATTTCTTTGCTTGT No data
Right 1069137393 10:64782726-64782748 GAGGCTTATCACTAATAGGAAGG No data
1069137383_1069137392 22 Left 1069137383 10:64782677-64782699 CCTTTGGAGATTTCTTTGCTTGT No data
Right 1069137392 10:64782722-64782744 AGAGGAGGCTTATCACTAATAGG No data
1069137383_1069137395 28 Left 1069137383 10:64782677-64782699 CCTTTGGAGATTTCTTTGCTTGT No data
Right 1069137395 10:64782728-64782750 GGCTTATCACTAATAGGAAGGGG No data
1069137383_1069137387 -7 Left 1069137383 10:64782677-64782699 CCTTTGGAGATTTCTTTGCTTGT No data
Right 1069137387 10:64782693-64782715 TGCTTGTTTCCTTCTGGGCAGGG No data
1069137383_1069137386 -8 Left 1069137383 10:64782677-64782699 CCTTTGGAGATTTCTTTGCTTGT No data
Right 1069137386 10:64782692-64782714 TTGCTTGTTTCCTTCTGGGCAGG No data
1069137383_1069137390 4 Left 1069137383 10:64782677-64782699 CCTTTGGAGATTTCTTTGCTTGT No data
Right 1069137390 10:64782704-64782726 TTCTGGGCAGGGGAGATTAGAGG No data
1069137383_1069137394 27 Left 1069137383 10:64782677-64782699 CCTTTGGAGATTTCTTTGCTTGT No data
Right 1069137394 10:64782727-64782749 AGGCTTATCACTAATAGGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069137383 Original CRISPR ACAAGCAAAGAAATCTCCAA AGG (reversed) Intergenic