ID: 1069137383

View in Genome Browser
Species Human (GRCh38)
Location 10:64782677-64782699
Sequence ACAAGCAAAGAAATCTCCAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 668
Summary {0: 73, 1: 122, 2: 58, 3: 45, 4: 370}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069137383_1069137387 -7 Left 1069137383 10:64782677-64782699 CCTTTGGAGATTTCTTTGCTTGT 0: 73
1: 122
2: 58
3: 45
4: 370
Right 1069137387 10:64782693-64782715 TGCTTGTTTCCTTCTGGGCAGGG No data
1069137383_1069137395 28 Left 1069137383 10:64782677-64782699 CCTTTGGAGATTTCTTTGCTTGT 0: 73
1: 122
2: 58
3: 45
4: 370
Right 1069137395 10:64782728-64782750 GGCTTATCACTAATAGGAAGGGG No data
1069137383_1069137386 -8 Left 1069137383 10:64782677-64782699 CCTTTGGAGATTTCTTTGCTTGT 0: 73
1: 122
2: 58
3: 45
4: 370
Right 1069137386 10:64782692-64782714 TTGCTTGTTTCCTTCTGGGCAGG 0: 24
1: 137
2: 69
3: 50
4: 273
1069137383_1069137394 27 Left 1069137383 10:64782677-64782699 CCTTTGGAGATTTCTTTGCTTGT 0: 73
1: 122
2: 58
3: 45
4: 370
Right 1069137394 10:64782727-64782749 AGGCTTATCACTAATAGGAAGGG No data
1069137383_1069137393 26 Left 1069137383 10:64782677-64782699 CCTTTGGAGATTTCTTTGCTTGT 0: 73
1: 122
2: 58
3: 45
4: 370
Right 1069137393 10:64782726-64782748 GAGGCTTATCACTAATAGGAAGG No data
1069137383_1069137391 7 Left 1069137383 10:64782677-64782699 CCTTTGGAGATTTCTTTGCTTGT 0: 73
1: 122
2: 58
3: 45
4: 370
Right 1069137391 10:64782707-64782729 TGGGCAGGGGAGATTAGAGGAGG 0: 85
1: 55
2: 69
3: 96
4: 500
1069137383_1069137392 22 Left 1069137383 10:64782677-64782699 CCTTTGGAGATTTCTTTGCTTGT 0: 73
1: 122
2: 58
3: 45
4: 370
Right 1069137392 10:64782722-64782744 AGAGGAGGCTTATCACTAATAGG No data
1069137383_1069137390 4 Left 1069137383 10:64782677-64782699 CCTTTGGAGATTTCTTTGCTTGT 0: 73
1: 122
2: 58
3: 45
4: 370
Right 1069137390 10:64782704-64782726 TTCTGGGCAGGGGAGATTAGAGG 0: 84
1: 53
2: 69
3: 60
4: 290
1069137383_1069137388 -6 Left 1069137383 10:64782677-64782699 CCTTTGGAGATTTCTTTGCTTGT 0: 73
1: 122
2: 58
3: 45
4: 370
Right 1069137388 10:64782694-64782716 GCTTGTTTCCTTCTGGGCAGGGG 0: 22
1: 98
2: 76
3: 79
4: 319

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069137383 Original CRISPR ACAAGCAAAGAAATCTCCAA AGG (reversed) Intergenic
902036706 1:13463214-13463236 AGAAGCAAAAAAATCACAAAAGG + Intergenic
902428541 1:16343972-16343994 ACAAAAAAAGAAAACTGCAAAGG + Intronic
902684181 1:18065079-18065101 ACCAGGAAAGAAGTCACCAAAGG - Intergenic
902813210 1:18901417-18901439 TCAAGCAAACAAACCTCAAATGG + Intronic
902830652 1:19010250-19010272 ACAGGCAAAGGAATCTGCCAAGG - Intergenic
903496220 1:23769379-23769401 AAAAACAAAAAAACCTCCAAAGG + Intergenic
905056165 1:35095962-35095984 ACAAACAAAGCAATATTCAAAGG - Intronic
905378624 1:37543712-37543734 ATGAGAAAAAAAATCTCCAAAGG + Intronic
905549637 1:38825907-38825929 ACAAGCAATGAAAAATCAAAAGG + Intergenic
905739126 1:40354196-40354218 ACAAGCAGAGAAAAATCCAGAGG + Intronic
906766629 1:48440132-48440154 ACAAGCAAAGACATCTCCAAGGG + Intronic
907842290 1:58169780-58169802 ACAAGCAAAGAAATCTCCAAAGG + Intronic
908298485 1:62737171-62737193 ACAAGCAAACAAAAATCAAAGGG - Intergenic
908300358 1:62756403-62756425 ATAAGCAAAGAAATCTCCAAAGG + Intergenic
908420989 1:63958237-63958259 ACAAGTAAGGAAATTTGCAAAGG - Intronic
908659809 1:66423952-66423974 ACAAGCAAAGAAATCTCCAAGGG - Intergenic
908954361 1:69603857-69603879 ACAAGCAAAGCAACCACAAACGG - Intronic
909359465 1:74744066-74744088 ACAAGCAAAGAAATCTCCAAAGG - Intronic
909764281 1:79335810-79335832 AAAGACAAAGAAATCTCCAATGG - Intergenic
911129824 1:94376676-94376698 ACAACCAAAGAAATCTCCAAAGG - Intergenic
911298918 1:96150053-96150075 ATAAGCAAAGAAATCTCCAAAGG + Intergenic
911751362 1:101501015-101501037 ACAAGCAAAGAAATCTCCAAAGG + Intergenic
911845675 1:102747966-102747988 GGAAACAAAGAAATCTCCAAAGG - Intergenic
912021247 1:105111164-105111186 ACAAGCAAAGAAATCTCCAAAGG + Intergenic
912330878 1:108818977-108818999 AAAAACCAAGAAGTCTCCAAAGG + Intronic
912597168 1:110890748-110890770 ACAAGCCAACAAATATGCAATGG - Intronic
912961580 1:114200682-114200704 ACCAGAAAAAAAATCTCCCATGG + Intergenic
913382568 1:118227677-118227699 ACAAGGAAAGAAATCTCCAAGGG + Intergenic
913469464 1:119174439-119174461 ATAAGCAAAGAAATCTCCAAAGG + Intergenic
913713453 1:121510701-121510723 ACAAGGAAAGAAATCTCCAAGGG + Intergenic
914925798 1:151885536-151885558 ACAAGGAAAGAAACTACCAAGGG - Intronic
915018979 1:152761717-152761739 ACAAGCAAAGAAGGCTCCAAGGG - Exonic
915260512 1:154673631-154673653 ATAAGCAAAGAAATCTCCAAAGG + Intergenic
915746287 1:158161419-158161441 ACATTTAAAAAAATCTCCAAAGG + Intergenic
916083574 1:161252269-161252291 GGAAACAAATAAATCTCCAAGGG + Intergenic
916114383 1:161474709-161474731 ATAAGCAAAGAAATCTCCGAAGG + Intergenic
916585823 1:166149331-166149353 AAAAGCTAAGAAATCCTCAAAGG - Intronic
916939474 1:169664152-169664174 ACAAGCAAAGAAATCTCCAAGGG + Intronic
917086078 1:171306994-171307016 ACAAGCAAAGAAATCTCCAAGGG + Intergenic
917227525 1:172800538-172800560 ACAAGCAAAGAAATATCCAAAGG + Intergenic
917279832 1:173369992-173370014 ACAAGCAAAGGACTCTCCAAGGG + Intergenic
917281100 1:173378838-173378860 ATAAGCAAAGAAATACCCAAGGG + Intergenic
917445854 1:175105374-175105396 ATAAGCAAAGAAATCTCCAAAGG - Intronic
917676225 1:177321758-177321780 ACAAGCAAAGAAATCTCCAAAGG + Intergenic
918689980 1:187467714-187467736 ACATGAAAAGATATCTCAAAAGG + Intergenic
918750227 1:188261586-188261608 ACAAGCAAAGAAATCTCCAAAGG - Intergenic
918881885 1:190134868-190134890 ACAAGGCAAGAAACCTCCAGAGG + Intronic
919206238 1:194424139-194424161 ACAAGCAAAGAAATCTCCAAAGG + Intergenic
919558600 1:199092400-199092422 ACAAGCAAAGAAACCTCCAAGGG + Intergenic
919738533 1:200968777-200968799 ACAAGAAAAGAGCTCTACAAAGG - Intergenic
919856649 1:201710895-201710917 ACAGGCACACACATCTCCAAGGG - Intronic
920448674 1:206040232-206040254 AAAAGAAAAGAAATCTCCAAGGG + Intronic
920618492 1:207520430-207520452 ACAAGCCAAGGTATCTCCCATGG - Intronic
920634925 1:207692633-207692655 ACAAGCCAAGGTATCTCCCATGG - Intronic
921012679 1:211158884-211158906 ACAAACAAAGCAATACCCAATGG - Intergenic
921019649 1:211224329-211224351 ATAAGCAAAGAAATCTCCAAAGG + Intergenic
921306145 1:213798804-213798826 ATAAGCAAAGACATCTCTATAGG - Intergenic
921561453 1:216663303-216663325 ATAAGCACAAAAATCTTCAAAGG - Intronic
921856975 1:219997201-219997223 AAAAGCCAAGAAAGCACCAAAGG - Exonic
922334166 1:224605631-224605653 ACCTGAAAAGAAATCTCAAAAGG - Intronic
922624631 1:227026640-227026662 ACAAGCAAAGAAAGATTCAATGG + Intronic
923819513 1:237421947-237421969 ACAAGCAAATAAACCTCAAAAGG - Intronic
924144643 1:241061415-241061437 AAAACCAAAGCAATCACCAATGG + Intronic
1063321754 10:5058093-5058115 ATAAGCAAAGAAATCTCCAAAGG - Intronic
1063414748 10:5864305-5864327 ACAAGCAAAGAAATCTCCAAGGG + Intronic
1064603614 10:17016703-17016725 ATAAGCAAAGAAATCTCCAAGGG - Intronic
1064938933 10:20711600-20711622 TCAAGCAAATAACTCTCCCAGGG - Intergenic
1065082362 10:22140938-22140960 ACAAGCAAAGAAATCTCCAAGGG + Intergenic
1065154195 10:22852920-22852942 ACAAACAAAAAAAGCTCAAAGGG + Intergenic
1065190800 10:23206270-23206292 AAAAGGAAAGAAATTTCCATTGG - Intronic
1065681413 10:28237339-28237361 AGAAGAAAAAAAATTTCCAAAGG + Intronic
1066314418 10:34229797-34229819 ACAAGCAAACAAATAACCAAAGG + Intronic
1066614621 10:37282490-37282512 ATAAGCAAAGAAATCTCCAAAGG - Intronic
1068240602 10:54297616-54297638 ATAAGAAAAGAAATATCCAAAGG + Intronic
1068414380 10:56698559-56698581 ACAGGCAATAAAATCTTCAAAGG - Intergenic
1068500262 10:57834822-57834844 AAAAGCAAAGAAATCTCCAAAGG + Intergenic
1069137383 10:64782677-64782699 ACAAGCAAAGAAATCTCCAAAGG - Intergenic
1069202862 10:65644808-65644830 TCAATCAAAGAAATCTTCAATGG - Intergenic
1069365134 10:67688293-67688315 ACAAACAAAGAAATCTCCAAAGG - Intronic
1070196501 10:74162011-74162033 ACAAACAAAAAAATCTTTAAAGG - Intronic
1071432174 10:85614815-85614837 ACAACCAAAGAAAACCACAATGG - Intronic
1071617467 10:87088500-87088522 AAGAGCAAAGAAATAACCAAGGG - Intronic
1071834810 10:89408506-89408528 ATAAGCAAAGAAATCTCCAAAGG + Intronic
1071934574 10:90514136-90514158 ATCAGCAAAGACATCTGCAAAGG + Intergenic
1072371703 10:94771235-94771257 ATAAGCAAAGAAATCTCCAAAGG - Intronic
1073858688 10:107709971-107709993 ACAATTGAAGAAATCTTCAAAGG + Intergenic
1074612992 10:115039186-115039208 ACAAGCAAAGAAATCTCCAAAGG + Intergenic
1074620383 10:115113396-115113418 ACAAACAAACAAAACTCAAAAGG - Intronic
1074742690 10:116500303-116500325 ACACGCAAAGAAATCTCCAAAGG - Intergenic
1075146289 10:119885656-119885678 ACAAGCAAAGAAATCTCCAAGGG + Intronic
1079374251 11:19878064-19878086 TGAAGCAGAGAAATGTCCAAGGG - Intronic
1079731268 11:23939448-23939470 ATAAGCAAAGAAATATCCAAAGG - Intergenic
1079811700 11:25005169-25005191 ACAAGGAGAGAAATCTCCAAAGG - Intronic
1080137195 11:28869316-28869338 ACAAGCAAACAAATATCCAGTGG + Intergenic
1081021233 11:37950193-37950215 ACAAGCAAAGAAATATTACATGG + Intergenic
1081027696 11:38036062-38036084 TCAAGCAAAGAAGTTTTCAAGGG + Intergenic
1081033387 11:38113623-38113645 ACAAGCAAAGAAATCTCCAAAGG + Intergenic
1081101137 11:39004145-39004167 AGAATGAAAGAAATCTCAAATGG + Intergenic
1081134977 11:39429367-39429389 AAAAGCAAAAAAATCTATAAAGG + Intergenic
1081145960 11:39562828-39562850 ACAAGCAAAGAAATCTCCAAAGG + Intergenic
1081421380 11:42877105-42877127 ATAAGCAAAGAAATCACCAAAGG + Intergenic
1081715227 11:45245420-45245442 AGAAGCAAAGAATTGTCTAAAGG + Intronic
1082906177 11:58310552-58310574 ACAAGCAAAGAAATCTCCAAAGG - Intergenic
1084210960 11:67622163-67622185 ATAAGCAAAGAGGTCTCCAAAGG + Intergenic
1086317347 11:85608626-85608648 ATAAGCAAAGAAATCTCCAAAGG + Intronic
1086812145 11:91323086-91323108 ACAAACAAAAAAATCAACAAAGG + Intergenic
1086881966 11:92160039-92160061 ACCTGAAAAGACATCTCCAAAGG + Intergenic
1087074962 11:94120313-94120335 ACAAGCAAAGAAATCTCCAAAGG + Intergenic
1087118671 11:94549948-94549970 CCAAGCCAAGAAATATCCCATGG - Intronic
1087224001 11:95577682-95577704 AGAAGCAAATAAGTCTCCATAGG + Intergenic
1087319221 11:96638524-96638546 ATAAGCAAAGAAATCACCAAAGG + Intergenic
1087459039 11:98422864-98422886 ACAAGCAAAGAAATCTCCAAAGG - Intergenic
1087683371 11:101238536-101238558 ATAAGCAAAGAACTCTCCAAAGG - Intergenic
1087690056 11:101310187-101310209 ACAAGCAAACTAATCTATAATGG - Intergenic
1088530738 11:110806411-110806433 ACATCCAAAGAAATGTCCACAGG - Intergenic
1091573951 12:1715043-1715065 ACAAGCAAAGAAATCTCCAAAGG - Intronic
1091618365 12:2066980-2067002 ACACCCAAAGAAATCCACAAGGG + Intronic
1091757392 12:3063203-3063225 ACCAGAAAAGACATCTCAAAAGG - Intergenic
1091914157 12:4255992-4256014 TCAAGCAACGAAAATTCCAAAGG + Intergenic
1092472260 12:8790402-8790424 ATAAGCAAAGAAATCTCCAAAGG + Intergenic
1093580609 12:20781158-20781180 GTAAGCAAAGAAATCTCCAAAGG - Intergenic
1094320004 12:29173286-29173308 ACAAGCAAGGAAATCTCCAAAGG - Intronic
1094338144 12:29383625-29383647 ACAAGCAAGGAAATCTCCAAAGG - Intergenic
1094686493 12:32721623-32721645 TCAAGCAAGGAATTCTCCAGGGG + Intronic
1094772447 12:33680193-33680215 TCAATCAAATAAATCTCCATTGG + Intergenic
1095543387 12:43337913-43337935 ACAAACAAATAAATCTTCTAGGG + Intergenic
1097084958 12:56460695-56460717 AAAAGAAAAGAAATCTGCCAAGG + Intronic
1097326296 12:58281082-58281104 ATATCCAAAGAAATATCCAAAGG - Intergenic
1097362995 12:58679234-58679256 ACAAAAAAAGATACCTCCAAAGG - Intronic
1097428264 12:59472996-59473018 ACAAGCAAAGAAATCTCCAAAGG + Intergenic
1097729369 12:63110137-63110159 AAAAGCAAAGGAGTCTCTAACGG + Intergenic
1097978936 12:65717401-65717423 AAAAGAAAAGACATCTCAAAAGG - Intergenic
1098377393 12:69831718-69831740 ACAAGGATAGAAATCCCCCAGGG - Intronic
1099376217 12:81898564-81898586 ACAAGCAAAGAAATCTCCAAGGG + Intergenic
1099414776 12:82372328-82372350 ACAAGCAAAGAACTCTCCAAAGG - Intronic
1099576897 12:84393476-84393498 ACAAGCAAAGAAATCTCCAAAGG - Intergenic
1099955384 12:89348421-89348443 ACAAGCAAAAATATTTACAAAGG + Exonic
1100092110 12:90984776-90984798 ACAAGCAAAGAAATCTCCAGGGG + Intronic
1100209753 12:92388718-92388740 ACAAGAAAAGAAATCTCCAAGGG + Intergenic
1100530267 12:95455871-95455893 ACAACCAAAGAAATCTCTAAGGG - Intergenic
1101704845 12:107211980-107212002 ATAAACAAAGACATCTCCAAAGG + Intergenic
1101779625 12:107823849-107823871 ACAAGCAAAGAAATCTCCAAAGG + Intergenic
1102661061 12:114528957-114528979 GCAGGCAAAGAAATCCCCCAGGG - Intergenic
1104767064 12:131336985-131337007 ACAAGCAAACAAATCTCCAAGGG + Intergenic
1105390202 13:19969401-19969423 ACAATCAAGTAAATCTCCTACGG - Intronic
1105764712 13:23547531-23547553 AGATGCAAAGAAATTCCCAAAGG - Intergenic
1106162656 13:27214847-27214869 ATAAGCAAAGAAATCTCCAAAGG + Intergenic
1107176454 13:37405132-37405154 ACATGCAAAGAAAACTGAAAAGG + Intergenic
1107213174 13:37883217-37883239 TCAAGCAAAGTAATTTCTAATGG + Intergenic
1107909780 13:45094899-45094921 ACAGGCAAGAAAACCTCCAAAGG - Intergenic
1107979773 13:45723522-45723544 ACAAGCAAAGAAAACACTGAAGG - Intergenic
1108848565 13:54702371-54702393 ACAAGCAAAGAAATCTCCAAAGG + Intergenic
1109308941 13:60670156-60670178 ACATACAAAGAAAGCTCCACTGG - Intergenic
1109424268 13:62150927-62150949 ACAAGCAAAGAAATATCCAAGGG + Intergenic
1109500999 13:63236009-63236031 ACAAACAAAGAAATCCTCAAAGG + Intergenic
1109513281 13:63406624-63406646 AAAAAAAAAGAAATCTGCAACGG + Intergenic
1109695952 13:65957709-65957731 ACAAGGAAATAAATATCAAATGG - Intergenic
1109805416 13:67434388-67434410 AGAAGCAAAGAAATGTTTAACGG - Intergenic
1111372497 13:87335646-87335668 GCAAGCAAGGAAATCTCCAAGGG + Intergenic
1111381499 13:87459353-87459375 ACAATGAAACAAAACTCCAATGG - Intergenic
1111565044 13:90003046-90003068 ACATGAAAAGACATCTCAAAAGG + Intergenic
1111795790 13:92918113-92918135 ACAAGGAAAGAAGTTTCAAAGGG + Intergenic
1111952099 13:94716847-94716869 AAAAGGACAGAAATCTCAAAAGG - Intergenic
1112409013 13:99146293-99146315 AAAATCAAAGAAATCCCGAAGGG - Intergenic
1112519082 13:100080406-100080428 ATAAGCAAAGAAATCTCCAAAGG + Intergenic
1112538333 13:100282923-100282945 ATAAGCAAAGAAATCTCCAAAGG + Intronic
1113203960 13:107895185-107895207 ACAAGCAAAGAAATCTCCAAAGG - Intergenic
1113551540 13:111196641-111196663 ATAAGCAAAGAAATCTCCAAGGG - Intronic
1115285495 14:31709808-31709830 ATATGCGAAGAAATCTCCAAAGG - Intronic
1116077051 14:40124218-40124240 AGAAGCAAAGAATGTTCCAAAGG - Intergenic
1116370015 14:44118309-44118331 ACAAGAAAAAAAAACCCCAAGGG - Intergenic
1117939849 14:60951362-60951384 AGAAGCAAATTAAACTCCAATGG - Intronic
1119407496 14:74407671-74407693 ACCAGCAAGGCCATCTCCAAAGG - Exonic
1120198754 14:81515125-81515147 ACAAGCAAAGAAATCTCCAAAGG + Intronic
1120504442 14:85337165-85337187 ACAACCAAAAAAAACTACAATGG + Intergenic
1120652418 14:87150736-87150758 ACAAGTAAAGAAACCTGCAGAGG + Intergenic
1120787473 14:88550569-88550591 AAAAGCAACGGAGTCTCCAATGG + Exonic
1121366943 14:93321599-93321621 ACAAGCAAACAATACCCCAAAGG + Intronic
1121772221 14:96556759-96556781 AGAAGCAAAAAACTGTCCAAAGG - Intronic
1123213582 14:106784936-106784958 AAAAGGAAAAAAATGTCCAAAGG + Intergenic
1124707055 15:31974939-31974961 ACAAGAGAAGAAATCTCACAGGG + Intergenic
1124907354 15:33883034-33883056 ACCATAAAACAAATCTCCAAGGG + Intronic
1124913530 15:33946485-33946507 AGATGCCCAGAAATCTCCAAGGG + Intronic
1126072107 15:44874287-44874309 ACAAGCAAAGAAATCTCCAAGGG - Intergenic
1126086083 15:45012382-45012404 ACAAGCAAAGAAATCTCCAAGGG + Intergenic
1126270217 15:46807595-46807617 AGAAGCAAAGAAATTTCCATGGG - Intergenic
1126919240 15:53502491-53502513 ACAAGCAAAGGAATCACCTTTGG + Intergenic
1128074555 15:64818157-64818179 ACTAGGAAGGAAAGCTCCAAAGG - Intronic
1128915394 15:71555999-71556021 ACAGACATAGAAATGTCCAATGG - Intronic
1129984159 15:79902262-79902284 ATAAGCAAATAAATATGCAATGG + Intronic
1130184157 15:81663097-81663119 AAAAGCACAGAAAACTACAAAGG - Intergenic
1130288284 15:82573225-82573247 AAAAAAAAAAAAATCTCCAAAGG - Intronic
1131100638 15:89686902-89686924 ACAAAGAAAGAAATCTACACTGG - Intronic
1131247929 15:90812003-90812025 ACAGGCAAACAAATATCTAAGGG - Intronic
1131296202 15:91151350-91151372 ACAAGCAAATAAATCACAACAGG - Intronic
1131411169 15:92209427-92209449 AGAAGCAAAGAAATCTCCAAGGG + Intergenic
1131665454 15:94566677-94566699 ACGTGGAAAGACATCTCCAAAGG + Intergenic
1133500150 16:6357999-6358021 ACAACCATTGAAATTTCCAAAGG - Intronic
1134008654 16:10835091-10835113 AAAAACAAAAAAATCTCCCAGGG - Intergenic
1134075154 16:11285584-11285606 TCAAGGAAAGACATCACCAAAGG + Intronic
1134299755 16:12979655-12979677 AAAAGAAAAGAAAATTCCAAAGG - Intronic
1134883183 16:17765711-17765733 ACAAGCAACAAAAACTTCAAAGG - Intergenic
1135339713 16:21635323-21635345 ATAAGCAAAGAAATCTCCAAAGG - Intronic
1135572396 16:23558756-23558778 AAAAGAAAAGAAATCTCAGATGG - Intronic
1135709004 16:24699269-24699291 ACAGGCAAAGAATTCTCACATGG + Intergenic
1137615133 16:49841869-49841891 ACAACCAAAGGACTCACCAAGGG + Intronic
1140632047 16:76864938-76864960 AAAAGCAAAGAAATCTTCCCTGG - Intergenic
1140737735 16:77913328-77913350 AAAAGCATAGACAACTCCAATGG - Intronic
1141073302 16:80978378-80978400 ATATGCTAAGACATCTCCAAAGG + Intronic
1141194119 16:81846911-81846933 TCAAGCAAACAATTCTCCATTGG + Intronic
1142312668 16:89323189-89323211 ACAGGGAGAGAAGTCTCCAACGG + Intronic
1142738466 17:1916739-1916761 TCAAGCAAAGAAATATACAGAGG - Intergenic
1144320326 17:14111062-14111084 ACAGACAAAGAAGTCTCAAAAGG - Intronic
1144327930 17:14199630-14199652 ACTAGCAAAGAATTCTTCAAGGG + Intronic
1144403036 17:14925230-14925252 CAAAGAAAAGAAACCTCCAAAGG + Intergenic
1145097560 17:20043762-20043784 AAATGCAAATAAATTTCCAAGGG + Intronic
1145804066 17:27713938-27713960 ACAAGCAAAGAAATCTCTAAGGG + Intergenic
1146310464 17:31764601-31764623 ATAAGCAAAGAAACCTCCAAAGG + Intergenic
1147531997 17:41287999-41288021 ACAAGGAAAAAAATCTTCATTGG + Intergenic
1148368401 17:47073824-47073846 ACAGGCCTAGAAAACTCCAAGGG + Intergenic
1148885618 17:50770171-50770193 AGAAGCAATGACATCTCCATGGG - Intergenic
1149073858 17:52575298-52575320 ACAAGCAAAGAAATCTCCAAGGG + Intergenic
1149209627 17:54288357-54288379 ACAAGCAAAGAAATCTCCAAAGG + Intergenic
1149268196 17:54950936-54950958 GCAAGCAATGAATTCTACAATGG + Intronic
1149322347 17:55494134-55494156 AGAAACAAAGTCATCTCCAAAGG + Intergenic
1151123690 17:71821691-71821713 AGAAGCAAATAAATCTCCTGGGG - Intergenic
1151205118 17:72501192-72501214 ATAAGCAAATCAATTTCCAAGGG + Intergenic
1151567971 17:74910476-74910498 ATAAGCAAAGAAATCTCCAAAGG + Intergenic
1151741273 17:75983881-75983903 ACCTGAAAAGATATCTCCAAAGG + Intronic
1153438010 18:5087576-5087598 ACAAGCAAAGAAATCTCCAAAGG + Intergenic
1153517428 18:5917106-5917128 TCAAACAAACAAATCTCCTATGG + Intergenic
1155025911 18:21940877-21940899 ACAAGAATAAAAGTCTCCAAAGG + Intergenic
1155070161 18:22307908-22307930 ACAAACAAAAAACTCTCCAAGGG - Intergenic
1155336176 18:24767519-24767541 ACAAGAGAAGAAATCTAGAAAGG + Intergenic
1155525230 18:26709377-26709399 TAAAGCAAAGAAATGTCAAAGGG - Intergenic
1157857941 18:51118370-51118392 ATAAGCAAAGAAATCTCCAAAGG - Intergenic
1158217596 18:55116258-55116280 CCAAGTAAGGCAATCTCCAAGGG + Intergenic
1159092190 18:63861720-63861742 AAAAGGAAAGAAATGTTCAATGG + Intergenic
1159831826 18:73286475-73286497 ATAGACAAATAAATCTCCAATGG + Intergenic
1161009420 19:1953164-1953186 ACCAGGAAAGAAAGCTCCCACGG - Intronic
1161185469 19:2916046-2916068 AAAAGTAAACAAATCTCAAAAGG - Intronic
1161598277 19:5163802-5163824 ACAAGCAAAGAAATCTCCAAGGG - Intronic
1162107876 19:8381589-8381611 ATAAGCAAAGAAATCTCCAAAGG + Intronic
1163984758 19:20935452-20935474 ACAAACAAAAAAACCCCCAATGG - Intronic
1164992992 19:32697975-32697997 ATAAGCAAAGAAATCTCCAAAGG - Intronic
1165045660 19:33102966-33102988 AAAAACAAAGCAATCTGCAAAGG - Intronic
1165753438 19:38276316-38276338 ACAAGCAAAAATAACTCCTAGGG - Intronic
1165847037 19:38824843-38824865 ATATGCAAAGAAATCTCCAAAGG + Intronic
1166903544 19:46086673-46086695 AAAAGTAAGGAAATATCCAAAGG - Intergenic
1166953244 19:46444555-46444577 ACAAACAAAAAAAACACCAAAGG - Intergenic
926328344 2:11804594-11804616 TGAAGCAAAGAAATCTACCATGG - Intronic
926437783 2:12854982-12855004 CCAAGCAAAGAAAACTCTATGGG + Intergenic
927118973 2:19936230-19936252 ATCAGCAAAGTAGTCTCCAATGG + Exonic
928263239 2:29786763-29786785 ACAAACAAAAAAAACTCCCAGGG - Intronic
928354003 2:30591764-30591786 ATAAGCAAAGAAAGCTGAAATGG - Intronic
928617674 2:33055861-33055883 ATAAGCAAAGAAATCTCCAAAGG - Intronic
929330324 2:40674270-40674292 ATAAGCAAAGAAATCTCCAAAGG + Intergenic
930038473 2:47102700-47102722 GTAAGCAAAGAAATCTCCAAAGG + Intronic
930311665 2:49749579-49749601 ACCAGCAAAGGCATTTCCAAAGG + Intergenic
931049554 2:58395442-58395464 AGAAGCAAACAAATCCCCAAAGG - Intergenic
931464905 2:62477400-62477422 ACAAACAAAAAAATCTCTCAGGG + Intergenic
931540438 2:63324364-63324386 ATAAGCAAAGAAATCTCCAAAGG + Intronic
931565680 2:63613587-63613609 AGAAGCAAAGGAAAGTCCAAGGG + Intronic
931732778 2:65167715-65167737 ATAAGCAAGGAAAAATCCAAAGG - Intergenic
932007761 2:67944628-67944650 AGAAGGAAAGAAATGTTCAATGG - Intergenic
932253622 2:70265709-70265731 ACAAGCCAAGATATCTCAACAGG - Intronic
933342105 2:81037377-81037399 ACAAGCAAAGAAATCTCCAAGGG + Intergenic
933850869 2:86365500-86365522 AGAAGCAAAGGCAGCTCCAAGGG - Intergenic
934219330 2:90067414-90067436 TCACGCAAAGAAATCCACAAGGG - Intergenic
935547520 2:104416729-104416751 ACAAGCAAATAAAGCTCCGAGGG - Intergenic
936802094 2:116282591-116282613 ATGAGCAAAGAAATCTCCAAGGG + Intergenic
937288494 2:120767787-120767809 ACAGGCAAAGAACTTGCCAAGGG - Intronic
937452158 2:122010634-122010656 CCAAGAAAGGAAATCTCCAAAGG - Intergenic
937524694 2:122754175-122754197 TCAGGCACTGAAATCTCCAAAGG + Intergenic
938806237 2:134809284-134809306 ATAAGCAAAGAAATCTCCAAAGG - Intergenic
939515370 2:143160744-143160766 ACAAGGAAAGAAATCTCCAGTGG - Intronic
939851808 2:147313504-147313526 ACAAGCAAAGAAATCTTTAAGGG + Intergenic
941243363 2:163068878-163068900 ATAAGCAAAGAAATCTCCAAAGG + Intergenic
941537600 2:166742042-166742064 ACAAGCAAAGAAATCTCCAAAGG - Intergenic
941679463 2:168381015-168381037 GAAAGCAAAGAAATTTCAAATGG + Intergenic
942577244 2:177376975-177376997 ACAATAAAAGCAATCTCCGAGGG + Intronic
942833844 2:180268536-180268558 ACAAACAAAAAAATGTCAAATGG - Intergenic
942919225 2:181350842-181350864 ACTAGCAAAGAAATCAGAAATGG - Intergenic
943103125 2:183510823-183510845 ATAAGCAAAGAAATCTCCAAAGG - Intergenic
943194367 2:184725139-184725161 ACAAGCTAAGAAATTTCCAAAGG - Intronic
943491478 2:188560148-188560170 ATAAGCAAAGAAATTACCTAAGG - Intronic
943839625 2:192562145-192562167 ACAAGGAAAAAAATCTTTAAAGG + Intergenic
944310025 2:198223118-198223140 ACAAACAAAAAAACCCCCAAAGG + Intronic
944341058 2:198600179-198600201 ACAACCAAAAAAAACTCCCAGGG - Intergenic
944680678 2:202073923-202073945 CCAAGCAAAGACAGCTACAAGGG - Intronic
944728945 2:202499034-202499056 ATAAGCAAAGAAATCTCCAAAGG + Intronic
946207408 2:218119815-218119837 ATAAGCAAAGAAATCTCCAAAGG - Intergenic
946666139 2:222051870-222051892 TAAAAAAAAGAAATCTCCAAGGG + Intergenic
947259755 2:228207741-228207763 ACATGCTAAGAAATATACAATGG + Intergenic
948556145 2:238812909-238812931 ACACGCAAACAAATCAACAAAGG - Intergenic
949053000 2:241907508-241907530 GCAAGCAAAGCTATCTCCAGCGG + Intergenic
1169548603 20:6677636-6677658 ATAAACAATGAAATCTCTAAAGG + Intergenic
1169655270 20:7915646-7915668 AAAAGATGAGAAATCTCCAAGGG + Intronic
1170196696 20:13696148-13696170 ACAAGCAAAGTCATCTCAAAAGG + Intergenic
1171261457 20:23738047-23738069 ATAGGCAACCAAATCTCCAAAGG + Intergenic
1171270596 20:23813938-23813960 ATAGGCAACCAAATCTCCAAAGG + Intergenic
1171432161 20:25089891-25089913 AGAAGCAGCGAAATCTCCACGGG + Intergenic
1172019798 20:31906052-31906074 AAAAGGAAAGAAAATTCCAAAGG + Intronic
1172340599 20:34154551-34154573 ACAATCAAAGAAATCTCCCAGGG + Intergenic
1177135012 21:17298910-17298932 ACAAGCAAAGAAATATCCATGGG + Intergenic
1178208303 21:30496600-30496622 TCAAGAAAAGAAATATGCAATGG + Intergenic
1183308111 22:37094266-37094288 ACTAGAAAAGACAACTCCAAAGG + Intronic
1184482536 22:44756250-44756272 ACAAGCAAAGGAAACTCAGACGG + Intronic
1184816498 22:46875809-46875831 ACAAACAAACAAATCTCTAAAGG + Intronic
1185059372 22:48598149-48598171 GCAAGAAAAGAATTCTCCAGCGG - Intronic
949311423 3:2702840-2702862 ACTACAAAAGAAATCTCTAATGG - Intronic
949435104 3:4020504-4020526 ACAAACAAACAAATATCCACTGG + Intronic
949449020 3:4165399-4165421 ATAAGTAAAGAAATCTCCAAGGG - Intronic
949850599 3:8416590-8416612 ACAAGTAATGAAATTTCCAAAGG - Intergenic
951020435 3:17776589-17776611 ACAAGCAAAGAAATCTCCAAAGG + Intronic
951239413 3:20271800-20271822 ACAAGCAAAGAAATATCCAAAGG + Intergenic
951495533 3:23321047-23321069 ACAAGCCAAGGAATGGCCAACGG - Intronic
952452972 3:33448765-33448787 ATAAGCAAAGAAATCTCCAAAGG + Intergenic
952941004 3:38444328-38444350 ACAAGCAAAGAAATCTCCAAAGG - Intergenic
953457022 3:43051582-43051604 ATAAGAAATGAAATGTCCAAGGG - Intronic
953622998 3:44548789-44548811 GGAAATAAAGAAATCTCCAAAGG - Intergenic
954232324 3:49226953-49226975 ACAAGCAAAGAAATCTCCAAAGG - Intronic
954519534 3:51212144-51212166 AGAATGAAAGAAATCACCAATGG - Intronic
954586929 3:51744442-51744464 ACAAGCAAAGAAATCTCCAAAGG + Intergenic
954598872 3:51852287-51852309 ACAAGCAAAGAAATCTCCAAAGG + Intergenic
955576847 3:60374862-60374884 AGCAGCAAAGAAAACTGCAAGGG - Intronic
955742555 3:62107547-62107569 ACATGGAAAAAAATCTCCAGAGG - Intronic
955953998 3:64269298-64269320 ACAAGCAAAGACATATGTAAAGG + Intronic
956843016 3:73157380-73157402 ATAAGCAAAGAAATCTCCAAAGG - Intergenic
957014718 3:75049364-75049386 AGAAGCAAAGAAATATTAAATGG - Intergenic
957422426 3:79988531-79988553 ACAAGGAAAGAAAGTACCAAAGG - Intergenic
958054540 3:88392466-88392488 ACAAGCAAAGAAAACTAAGAAGG + Intergenic
958549268 3:95593362-95593384 ATAAACAAAGAAATCTCCAAAGG - Intergenic
958575865 3:95949457-95949479 ATAAACAAAGAAATCTCCAAAGG - Intergenic
958601336 3:96299907-96299929 ATAAGCAAAGAAATCTCCAAAGG + Intergenic
959460155 3:106615380-106615402 ACAAGCATAGAAATGTGAAATGG - Intergenic
960063634 3:113348648-113348670 ATAAGCAAAGAAATCTCCAAGGG + Intronic
960222439 3:115129488-115129510 ACAACCAAAAAAATGGCCAATGG + Intronic
960413275 3:117354160-117354182 TCAAGTAAAGAAATCTACCAGGG + Intergenic
961168863 3:124781583-124781605 GCAACTAAATAAATCTCCAAGGG + Intronic
961233260 3:125340043-125340065 ATAAGCAAAGGAAAATCCAAAGG + Intronic
961261608 3:125606487-125606509 ACAAGCAAAGAAATCTCTAAGGG + Intergenic
962120810 3:132557926-132557948 AAAAGGAAAAAAGTCTCCAAAGG - Intergenic
962721452 3:138178852-138178874 ACAAGCAAAGAAAACACCTCTGG + Intergenic
962834991 3:139181977-139181999 GCAAGCTGAGAAATCTCAAAAGG - Intronic
963021199 3:140874470-140874492 ACAAGCAAAGAAATCTCCAAAGG + Intergenic
963409269 3:144907732-144907754 ACAAGCAAAGAAATCTCCAAAGG - Intergenic
963412895 3:144954204-144954226 ACTTGCAAAGATATCTCTAAAGG + Intergenic
963696689 3:148572955-148572977 ATGAGCAAAGAAATCTCCAAAGG + Intergenic
963992344 3:151668848-151668870 ATAAGCAAGGAAATCTCCAAAGG - Intergenic
964064439 3:152561942-152561964 ATAAGCAAAGAAATCTCCAAAGG + Intergenic
964465994 3:156993727-156993749 ACAAGCAAAGATACCTCCTTAGG + Intronic
964714432 3:159707058-159707080 ACAAGCAAATAAAATTTCAATGG + Intronic
964972186 3:162576649-162576671 ATAAGCAATGAAATCTCCAAAGG + Intergenic
965062689 3:163803708-163803730 ACAAGCGAAGAAATCTCCAAAGG + Intergenic
965354285 3:167654915-167654937 AAAAGCAAAGAAAATGCCAAAGG + Intergenic
966879146 3:184339983-184340005 ACAAGCAAACAAAAATGCAAAGG - Intronic
967583560 3:191187564-191187586 ATAAGCAAAGAAACCTCCAAAGG + Intergenic
967760862 3:193225152-193225174 ACCTGAAAAGACATCTCCAAAGG - Intergenic
967925375 3:194641611-194641633 ACAAGAAAAAAAATTTGCAAGGG - Exonic
968012297 3:195291747-195291769 TCAACCAAAGAGATGTCCAAGGG - Exonic
968191976 3:196675247-196675269 ACAAGCTAAGAAATCAACACTGG - Intronic
969922370 4:10552466-10552488 ACTGGGAAAGATATCTCCAAAGG - Intronic
970722967 4:19009428-19009450 ACATGAAAAGACATCTCAAAAGG + Intergenic
970789499 4:19839936-19839958 ACAAGCAAACAAATGAACAAAGG + Intergenic
971281267 4:25244247-25244269 ATAAGCAAAAAAATCTCCAAAGG - Intronic
971290771 4:25337001-25337023 AAAAGCAAAGTTATTTCCAAAGG - Intronic
971578414 4:28305142-28305164 ACAAGCAAAGAAATCTCCAAGGG + Intergenic
972133364 4:35863067-35863089 ACAAGCAAAGAAATCTCCAAGGG - Intergenic
973045805 4:45533582-45533604 ATAAGCAACGAAATATCCAAAGG + Intergenic
973069559 4:45840126-45840148 ACAAGTTAAGAAATGTGCAAAGG + Intergenic
973334383 4:48941645-48941667 GCAAACAAAGAAATCATCAAGGG + Intergenic
973594394 4:52471513-52471535 ACAAGCAAAGAAATCCCCTATGG - Intergenic
974029284 4:56761836-56761858 ACCTGAAAAGATATCTCCAAAGG - Intergenic
974038227 4:56835773-56835795 GAAAGAAAAGATATCTCCAAAGG + Intergenic
974174433 4:58306484-58306506 ATAAGCAAAGAAATCTCCAAAGG + Intergenic
974187255 4:58460221-58460243 ATAAGCAAAGAAATCTCCAAAGG + Intergenic
974478454 4:62414292-62414314 ATAAGCTAAGAAATCTCACATGG + Intergenic
974526495 4:63054977-63054999 ATAAGCAAGGAAATCTCCAAAGG + Intergenic
974537073 4:63186759-63186781 ACAAGGAAAGAAATATCCAAAGG + Intergenic
974821817 4:67076368-67076390 ACAAATAAAGGAATCTCCAAAGG + Intergenic
975411481 4:74056536-74056558 ACGAGGAAAGAAATCTGCATAGG - Intergenic
976162350 4:82216737-82216759 AAAAGCAAAGGAACCACCAAAGG + Intergenic
976188232 4:82464338-82464360 CCAAGCAAAGAAACCAGCAAAGG + Intergenic
976358543 4:84149744-84149766 GCAATCAAAGAAATCACAAAAGG + Intergenic
976361815 4:84188162-84188184 ACAAGGAAAGAAAAATTCAAAGG + Intergenic
977333080 4:95662499-95662521 AGAAGCAAAGAGATTTCCAATGG - Intergenic
977834981 4:101636143-101636165 ACAAGCAAAGAAATCTCCAAGGG - Intronic
977887451 4:102269347-102269369 ACAAACAAACAAAAATCCAAAGG - Intronic
978324812 4:107540740-107540762 ATACACAAAGAAATCCCCAAAGG - Intergenic
978403406 4:108354697-108354719 ACAAGCATAGTTATCTTCAAAGG - Intergenic
978638684 4:110842816-110842838 AGAAGCAAAGAAATCTCCTGAGG - Intergenic
978747118 4:112207580-112207602 ACAAGCAAAGAAATCTCTAAAGG + Intergenic
978912996 4:114087360-114087382 AGAAGCAAACAAATCATCAAGGG + Intergenic
980290958 4:130847083-130847105 ACAAGCAAATAAATCCCCAAAGG - Intergenic
980961039 4:139476043-139476065 ACAAGAAAATAATTGTCCAATGG - Exonic
981591570 4:146369506-146369528 ACCAGTAAAGAAATATTCAAAGG - Intronic
982701060 4:158660112-158660134 ATAAGCAAAGAAATCTCCAAAGG + Intergenic
982877238 4:160664482-160664504 ACAAGCAAAGAAATCTCCAAAGG + Intergenic
983309356 4:166037884-166037906 ACAAAGAAAGAAATCTGCCAAGG - Intronic
983610483 4:169639021-169639043 AAAAGAAAAGAAAACACCAATGG - Intronic
983817000 4:172143428-172143450 ACAAGGAAGGAAATCTACTAGGG - Intronic
983834988 4:172375040-172375062 ATAAGCAAAGAAATCTCCAAAGG - Intronic
984917383 4:184736566-184736588 ATAAGCAAAGAAATCTCCAAAGG + Intergenic
987545306 5:19305190-19305212 ATAAGCAAAGAAATCTCCAAAGG - Intergenic
987739734 5:21891734-21891756 ACAAGCAAATCAATATCCCAAGG + Intronic
987929831 5:24389312-24389334 ACAAGCAAATAAATCTCCAAAGG + Intergenic
988353865 5:30147264-30147286 ATAACCAAAGAATTCTCCAATGG - Intergenic
988357747 5:30199757-30199779 ACAAGCAAAGAAATCTCCAGAGG + Intergenic
988440871 5:31231311-31231333 AAAAGGAAAGAAATTCCCAAAGG - Intronic
988592080 5:32557731-32557753 ACAAGCAAAGAAATCTCCAAAGG - Intronic
988605561 5:32675851-32675873 ATAAGCAAGGAAATCACCAAAGG - Intergenic
988967198 5:36431624-36431646 AAAAGAAAAAAAATATCCAAAGG - Intergenic
989038728 5:37203924-37203946 ACAAGCAAATAAAAATTCAAAGG - Intronic
989496180 5:42113446-42113468 GTAAGCAAAGAAATCTCCAAAGG + Intergenic
989957284 5:50372471-50372493 ATAAGCAAAGAAATCTCCAAAGG + Intergenic
990116672 5:52399435-52399457 ACAAGCAAAGAAATCTCCAAAGG + Intergenic
990367935 5:55089045-55089067 ATAAGCAAAGAAATCTCCAAAGG - Intergenic
990634499 5:57709515-57709537 ACATGAAAAGACATCTCAAAAGG + Intergenic
990849801 5:60190073-60190095 ACAATCAAAGACAACTCCAAAGG + Intronic
991370750 5:65916873-65916895 TCAAGCAAAGAGAACTCCACTGG - Intergenic
991390056 5:66133059-66133081 ACTATCAAAGAATTTTCCAATGG - Intergenic
991479958 5:67067663-67067685 ACCAGCAAAGGGACCTCCAAAGG - Intronic
992049295 5:72928444-72928466 ATAAGCAAAGAAATCTCCAAAGG + Intergenic
992545711 5:77812144-77812166 ACAAGCAAAGAAATCTCCTAGGG + Intronic
993254757 5:85576231-85576253 CTAAGTAAAGAAATTTCCAAGGG + Intergenic
993874968 5:93295750-93295772 ACAAGCAGAAAAATCTCACAGGG + Intergenic
994112617 5:96023884-96023906 ACAAGGAAAGTAATTTCCATAGG - Intergenic
994231801 5:97316134-97316156 ATAAGTAAAGAAATTTCCAAAGG - Intergenic
994746380 5:103683239-103683261 ACCAGCATAGAATTTTCCAATGG - Intergenic
994810283 5:104508678-104508700 TCAAGGAAAGAAATCTCAAAGGG + Intergenic
994929608 5:106164268-106164290 ACAAGAAAAAAAATATTCAAAGG + Intergenic
995138194 5:108702930-108702952 ACAAGGTAAGAAATTGCCAATGG - Intergenic
995583485 5:113623672-113623694 ACAAGCAAAGATATCTCCAAGGG - Intergenic
995706374 5:114992518-114992540 ATAAGCAAAGAAATCTCCAAAGG + Intergenic
996099297 5:119430710-119430732 ATAAGCAAAGAAGTCTCCAAAGG - Intergenic
996680314 5:126223433-126223455 ATAAGCCAAGAAATCTCCAAAGG + Intergenic
997072335 5:130635730-130635752 ATAAGCAAAGAAATCTCCAAGGG + Intergenic
997101295 5:130971803-130971825 ACAGGTAAAAGAATCTCCAAGGG + Intergenic
997872910 5:137520905-137520927 ACCAGCAAAGATTTCTCAAATGG - Intronic
998111396 5:139505469-139505491 ATAAGCAAAGAAATCTCCAAAGG + Intergenic
998450669 5:142232128-142232150 ATCAGCTCAGAAATCTCCAAGGG - Intergenic
998914999 5:147003280-147003302 ATAAGCAAAGAAATTTCCAAAGG + Intronic
999085067 5:148880793-148880815 GCAAGCAAAGAAATGTTAAAAGG + Intergenic
999921877 5:156330028-156330050 AAAAAAAAAAAAATCTCCAAGGG + Intronic
1000085160 5:157882153-157882175 ATAAGCAAAGAAATCTCCAAAGG + Intergenic
1000233631 5:159337667-159337689 ACCTGAAAAGACATCTCCAAAGG - Intergenic
1000765861 5:165287453-165287475 GCAAGGAAACATATCTCCAAAGG + Intergenic
1000858929 5:166433264-166433286 AAAAAAAAAAAAATCTCCAATGG + Intergenic
1002032097 5:176437835-176437857 AAAAGCAAAGAAATCTGAAATGG - Intergenic
1003752789 6:9079983-9080005 AGAAGGAAAGACATGTCCAAAGG - Intergenic
1003805724 6:9724431-9724453 ATAAGCAAAGAAATCTCCAAGGG + Intronic
1004087865 6:12469525-12469547 ACAAGCAGACATTTCTCCAAAGG - Intergenic
1004531294 6:16457825-16457847 ACAAGCAAAGAAATTTCCAAAGG + Intronic
1004812171 6:19273350-19273372 ATAAGCAAAGAAATCTCCAAAGG + Intergenic
1005261953 6:24070611-24070633 ACATGCAAACAAATCAGCAAAGG + Intergenic
1006221713 6:32497160-32497182 ACAAGCAAAGAAATCTCCAAGGG + Intergenic
1006242313 6:32694765-32694787 ACAAGCAACCAAAGCACCAATGG + Intergenic
1006717294 6:36128786-36128808 ACAAGGAAAGAAATTTGCTAGGG - Intronic
1007029959 6:38618547-38618569 ACAGGCAAAGAAATCATCAAGGG + Intronic
1007844799 6:44744637-44744659 ACAAGGACAGAAATCTTGAAAGG + Intergenic
1008066830 6:47059034-47059056 ACATCCCAAGAAGTCTCCAAGGG + Intergenic
1008367188 6:50695396-50695418 AAAAAAAAAAAAATCTCCAAAGG + Intergenic
1008526843 6:52416288-52416310 ACAAGGAAAGAGAATTCCAACGG + Intergenic
1008587067 6:52959912-52959934 ATAAGTAAAGAAATCTCCAAAGG - Intergenic
1009386010 6:63084663-63084685 ACAAGCAAATAAATCTCCAAGGG - Intergenic
1009666425 6:66687046-66687068 ACATTCGAAGAGATCTCCAAGGG - Intergenic
1009872711 6:69470273-69470295 ATAAGCAAAGAAATCTCCAAAGG + Intergenic
1010074875 6:71787692-71787714 ATAAGCAAAGAAATCTCCAAAGG + Intergenic
1010124336 6:72414633-72414655 AAAATCAAAGGATTCTCCAATGG - Intergenic
1010269761 6:73906013-73906035 ATAAGCAAACAAATCTCCAAAGG + Intergenic
1010915135 6:81606941-81606963 AGAAGCAAAGTAATCTTCGAAGG - Intronic
1011175290 6:84552832-84552854 ACAAGCAAAGAAATATTTAATGG - Intergenic
1011375118 6:86679252-86679274 ACAAGAAAAGAAATCTCCAAAGG - Intergenic
1011512815 6:88120077-88120099 AAATTCAAAGAATTCTCCAATGG - Intergenic
1011701679 6:89960901-89960923 ACAACCAAAGAAATACCTAAGGG - Intronic
1012441627 6:99266676-99266698 ATAAGCAAAGAAATCTCCAAAGG - Intergenic
1012772979 6:103463936-103463958 ACAAGGAATGGAATCTCCACTGG + Intergenic
1012915093 6:105161536-105161558 ACAGGCAAAGAGATCCCCAGGGG + Exonic
1013238432 6:108220585-108220607 ACAAACAATGAAATCACCTAAGG + Intronic
1013907920 6:115239013-115239035 ATAAGCAAAGAAATCTCCAAAGG - Intergenic
1014055238 6:117007058-117007080 ACAAGCATCTAAATCTACAAGGG + Intergenic
1014685567 6:124495676-124495698 TCAACCAAAGAAAATTCCAAAGG + Intronic
1016183956 6:141178297-141178319 ATAAGAAAAGAAATCTCCAAAGG + Intergenic
1016421058 6:143883459-143883481 ACATGCAAAGAAAGCAACAAGGG - Intronic
1018452710 6:163924147-163924169 AGAAGCACAGAAATATTCAAGGG + Intergenic
1021205618 7:17776312-17776334 ACAAGCAAGGAGATTTCTAATGG - Intergenic
1021272353 7:18605667-18605689 ACAAACAAACAAAACTCCAGGGG - Intronic
1021356649 7:19658908-19658930 ATAAGCAAAGAAATCTCCAAAGG - Intergenic
1021746251 7:23744491-23744513 ACAAGAAAATATAACTCCAAAGG - Intronic
1021756796 7:23859945-23859967 ACAAGCAAAGAAATCTCCAAAGG - Intergenic
1022192328 7:28028217-28028239 ACAAGCAATGAAATACCCAGAGG - Intronic
1022383121 7:29879075-29879097 ACCAGCAAACAGATCTCCCAGGG - Exonic
1022652238 7:32287849-32287871 ACAGGAAAAGGAATCTACAATGG + Intronic
1022753890 7:33263275-33263297 ACAAGCACTGAAATGTACAATGG - Intronic
1023078029 7:36502627-36502649 ACAAGCAAAGAAATCTCCAAAGG - Intergenic
1024615272 7:51106486-51106508 ACAAGAAAAGAGTTCTCCCAGGG + Intronic
1024735211 7:52296949-52296971 ATAAGCAAAGAAATCTCCAAAGG + Intergenic
1026016770 7:66677772-66677794 AAAAAAAAAGAAATCTACAAAGG + Intronic
1026575418 7:71567450-71567472 ACAAACAAAAAAATCTCTACAGG - Intronic
1027791040 7:82639214-82639236 ACAAGCAAAGAAATCTCCAAAGG + Intergenic
1028135292 7:87218646-87218668 AGGAGCAAAGAAATCTGTAACGG + Intronic
1028380965 7:90197965-90197987 ACAAACCATGAAATCACCAATGG - Intronic
1028495297 7:91454190-91454212 ATAAGCAAATAAATATTCAAAGG - Intergenic
1029082920 7:97988912-97988934 AGAAAGAAAGAAATCGCCAAAGG - Intronic
1029092016 7:98055958-98055980 ACAAGGAGAGAGAGCTCCAAAGG - Intergenic
1030420446 7:109301336-109301358 ACAAGCAAAGAAATCTCCAAAGG + Intergenic
1030644688 7:112046944-112046966 AGAATCACAGAAATCTGCAAAGG + Intronic
1031731706 7:125309959-125309981 ACAAGCAAAGAAATCTCCAAAGG + Intergenic
1031805497 7:126302122-126302144 AAAAGAAAAGAAAGGTCCAAGGG - Intergenic
1031936797 7:127743322-127743344 AGAGGCAAAGAAAGCTTCAAGGG - Intronic
1032203747 7:129843353-129843375 ACAAGCAAGGAACTCTTCCATGG + Intronic
1032357265 7:131222490-131222512 AGCAGCCATGAAATCTCCAAAGG - Intronic
1033121096 7:138667275-138667297 ACCAGCAAAGAATTTTCCATGGG - Intronic
1033230095 7:139590363-139590385 AAAAGTAAAGAAATCCCTAAAGG + Intronic
1033674430 7:143525235-143525257 ACAAGGGAAAAAAACTCCAATGG - Intergenic
1033697406 7:143804212-143804234 ACAAGGGAAAAAAACTCCAATGG + Intergenic
1033759325 7:144422787-144422809 ATAAGCAAAGAAATCTCCAAAGG - Intergenic
1033797581 7:144865795-144865817 ACCACCAAAGCAATCTCAAAAGG - Intergenic
1034516373 7:151583698-151583720 AAAAGGAAAGAAATTTTCAAAGG - Intronic
1035829190 8:2676199-2676221 AAAAGTAATGCAATCTCCAATGG - Intergenic
1036029789 8:4956186-4956208 AAAAGAAAACAAATCTCCAGTGG - Intronic
1037157817 8:15726819-15726841 AAAAGAAAAGAAATATTCAATGG + Intronic
1037219113 8:16495815-16495837 ACAAGGAAAGAAATCTCTCTGGG - Intronic
1037353024 8:17983054-17983076 TCAAGAAAAAAAATCTCAAAAGG - Intronic
1038389471 8:27181471-27181493 ACAAGCAAAGAAATCCTCTTTGG + Intergenic
1038430865 8:27498266-27498288 ACAAGCAAAGAAATCTCCAAGGG - Intronic
1038638709 8:29307114-29307136 ATAAGCAAAGAAATCTCCAAAGG + Intergenic
1038720833 8:30034107-30034129 AAAACCGAAGAAATGTCCAATGG + Intergenic
1039275924 8:35934142-35934164 ACAAGCAAGTAAATCTCCAAGGG + Intergenic
1039693255 8:39883360-39883382 GTAAGCAAAGAAATCTCCAAAGG - Intergenic
1039999756 8:42566018-42566040 ACAAGCAAAGAAATCTCCAAAGG - Intergenic
1040527134 8:48235178-48235200 ACAAGCAAAGAAATCTCCAAGGG + Intergenic
1040667951 8:49654869-49654891 ATAAGCAAAGAAATCTCCAAAGG - Intergenic
1040796879 8:51297141-51297163 ACAAGCAAAGAAATCTCCGAGGG - Intergenic
1040953309 8:52956776-52956798 ATAAGCAAAGAAATCTCCAAAGG + Intergenic
1040971541 8:53141419-53141441 ACAAGCAAAGAAATCTCCAAAGG - Intergenic
1041000013 8:53440725-53440747 ACCAGCAAAGAAATCTCCAAAGG - Intergenic
1041001830 8:53461717-53461739 ATCAGCAAAGAAATCTCCAAAGG + Intergenic
1042050793 8:64703874-64703896 ACCAGCAAAGAAAAAGCCAAAGG - Intronic
1042525639 8:69762001-69762023 ACATGGACACAAATCTCCAAAGG - Intronic
1042771828 8:72390087-72390109 ACAAGCAAAGAAATCTCCAAGGG + Intergenic
1042919533 8:73908149-73908171 ACAAGCAAAGAAATCTCCAAGGG + Intergenic
1042984994 8:74573678-74573700 AAAAGACAAGAAATGTCCAAAGG + Intergenic
1043256983 8:78149748-78149770 ACAAGCAAAGAAATCTCCAAAGG + Intergenic
1043686003 8:83086738-83086760 ACAAACAAACAAATCTGGAAGGG + Intergenic
1044005517 8:86932379-86932401 ACAAGCAAAGAAATCTCCAAGGG - Intronic
1044028714 8:87207968-87207990 ATGAACAAAGAAATCTACAAAGG - Intronic
1044466722 8:92515359-92515381 AAAAGTAATGAAATCTGCAATGG - Intergenic
1044469222 8:92546808-92546830 TCAAGCAAACTAATCTCAAATGG - Intergenic
1045546834 8:103137087-103137109 ACAAAAAAAGAATTCTCCTAAGG - Intronic
1045858468 8:106790693-106790715 ACAAGCAAAGAAATCTCCAAGGG + Intergenic
1046653096 8:116861181-116861203 AAAAGCAGAGAAATCTGTAATGG + Intronic
1046706774 8:117462604-117462626 AAATGCTAAGAAATCTACAAAGG + Intergenic
1046963098 8:120130601-120130623 ACAAGGAAAGAAATGTAAAATGG + Intronic
1047631482 8:126713469-126713491 CCAAACAAAGAAGCCTCCAAAGG - Intergenic
1048128738 8:131668011-131668033 TGAAGAAAAAAAATCTCCAAAGG + Intergenic
1048633048 8:136265426-136265448 ACAAAAATAGAATTCTCCAATGG - Intergenic
1048835250 8:138513096-138513118 AGGAGAAAAGAAATCCCCAAGGG + Intergenic
1049424261 8:142531091-142531113 GCAGGCAAAGAAGTCTCCATGGG + Intronic
1050101742 9:2127153-2127175 ACAAGCAAAGAAATGTTAAGAGG - Intronic
1050286772 9:4111094-4111116 ATATACAAACAAATCTCCAAAGG + Intronic
1050495141 9:6232771-6232793 AACAGCAATGAAATCACCAAGGG - Intronic
1051935190 9:22436676-22436698 ATAAGCAAAGAAATCTCCAAAGG + Intergenic
1052057850 9:23923737-23923759 ATAATCAAAGACATCTTCAAAGG - Intergenic
1052715087 9:32105979-32106001 AAAAGCAAAAAAGTCTCCAAGGG + Intergenic
1053196319 9:36121833-36121855 AAAAGCAAGGCAATCTCTAAAGG + Intronic
1053614154 9:39745783-39745805 ACAGGCAAAGAAAGCCCCAAAGG + Intergenic
1053872182 9:42503722-42503744 ACAGGCAAAGAAAGCCCCAAAGG + Intergenic
1054239363 9:62596610-62596632 ACAGGCAAAGAAAGCCCCAAAGG - Intergenic
1054261071 9:62865407-62865429 ACAGGCAAAGAAAGCCCCAAAGG + Intergenic
1054553494 9:66631137-66631159 ACAGGCAAAGAAAGCCCCAAAGG - Intergenic
1055096730 9:72421801-72421823 TCAGGCAAAGAAGTTTCCAAGGG - Intergenic
1055458364 9:76493610-76493632 ACAAGCAAAGAAATCTCCAAAGG - Intronic
1056002859 9:82235737-82235759 AAAAAAAAAAAAATCTCCAAAGG - Intergenic
1056028091 9:82521784-82521806 ACATGCATAAAAATCACCAAGGG + Intergenic
1056058106 9:82850333-82850355 AGAAGGAAAGAAAGATCCAAAGG + Intergenic
1056392865 9:86155140-86155162 ATAAGCAAAGAAATCTCCAAAGG - Intergenic
1056536312 9:87530805-87530827 ACATCCAAAGAAACCCCCAAGGG + Intronic
1056706262 9:88954853-88954875 ACAAACAAAAACATCTCCAGAGG - Intergenic
1056794881 9:89651288-89651310 AAAAACAAAGAAATAGCCAATGG + Intergenic
1057119958 9:92562532-92562554 ACAACCTATGAAATCTCTAATGG - Intronic
1058048551 9:100383457-100383479 ACCTGAAAAGATATCTCCAAAGG - Intergenic
1059351217 9:113666299-113666321 ACAACAAAAGAATTGTCCAAAGG + Intergenic
1060668282 9:125446582-125446604 ACAAGCACAGCCATCTACAAAGG + Intronic
1060973998 9:127754426-127754448 CCAAGCAAAGCCATCCCCAAAGG + Intronic
1061257588 9:129461388-129461410 CCAAGAAATGAAATCTCCACCGG + Intergenic
1061452060 9:130673052-130673074 ACAAACAAAGCAATTCCCAAAGG - Intronic
1061561488 9:131407028-131407050 ATAAGCAAAGACATCTCATATGG + Intronic
1061642757 9:131972413-131972435 CAAAGCAAAGAAATATCCTAAGG + Intronic
1061690482 9:132323927-132323949 AAATGGAAAGAAATTTCCAAAGG + Intronic
1062709914 9:137969523-137969545 ACAAGCAACAAATTCTCCAAAGG - Intronic
1185967385 X:4622862-4622884 ACAAACAAAGATTTCTCCACTGG + Intergenic
1186680596 X:11869907-11869929 ATATGGAAAGAAATATCCAATGG - Intergenic
1187073017 X:15907455-15907477 ACCAGCAACCAAATCTGCAAGGG - Intergenic
1188097439 X:26042248-26042270 ATAAGCAAAGAAGTCTCCAAAGG + Intergenic
1188136437 X:26499603-26499625 ACAAGCAAAGAAATCTCCAAAGG + Intergenic
1188505584 X:30880189-30880211 AAAATCAAAGAAATGTGCAAAGG + Intronic
1188598395 X:31929602-31929624 TCAAGCAGACAAATCTCCAGTGG - Exonic
1189470272 X:41308584-41308606 AAAAGAAAAAAAAGCTCCAAGGG - Intergenic
1189683568 X:43541154-43541176 ACCTGAAAAGACATCTCCAAAGG + Intergenic
1189999963 X:46676310-46676332 ACAAGCAATGAATTCTGCAGCGG - Intronic
1190156908 X:48001420-48001442 ACAAACAAACAAATCCCAAAAGG + Intronic
1190541374 X:51481754-51481776 AGAAGCAAAGAAATCTCCAAAGG + Intergenic
1191206021 X:57834880-57834902 CCAAGCAAAGAAATCTCCAAGGG - Intergenic
1191735586 X:64385012-64385034 ACGAGCAATGAAATGTCCTAAGG - Intronic
1192253181 X:69430726-69430748 ACAAGCAAAGGAAACAGCAAAGG + Intergenic
1192482848 X:71500059-71500081 ACAAGAAAAGAGATCTCCAAGGG - Intronic
1192762304 X:74105857-74105879 TAAAGCAAAGAAAGCTCCAAGGG + Intergenic
1192870099 X:75176618-75176640 ATAAGCAAAGAAATCTCCAAAGG - Intergenic
1193550286 X:82884089-82884111 ACTTGGAAAGATATCTCCAAAGG - Intergenic
1193700260 X:84751511-84751533 CCAAGCAATGTAATCTCTAAAGG + Intergenic
1194616435 X:96109685-96109707 GCAAGAAAAGAAATATCCACAGG + Intergenic
1195439486 X:104884887-104884909 ATAAGCAAAGAAATCTCCAAAGG + Intronic
1195552470 X:106184882-106184904 GCAAGCAAAGAAATCTCCAAGGG - Intronic
1195644689 X:107215996-107216018 ACAAGCATACACATCCCCAAAGG - Intronic
1195882805 X:109610360-109610382 ACAAGCAGAGAACTCTCTGAGGG + Intergenic
1196127434 X:112114661-112114683 ACAAACAAAGAAATCTCCAAAGG - Intergenic
1196363842 X:114900039-114900061 AAAAAGAAAGAAATATCCAAGGG - Intronic
1196488901 X:116245635-116245657 ACAATAAAAGAAATCTCCAAAGG + Intergenic
1196662030 X:118279787-118279809 ATAAGCAAAGAAATCTCCAAAGG - Intergenic
1197513320 X:127397146-127397168 ACAAGCAAAGAAATCTCCAAAGG + Intergenic
1197925521 X:131643069-131643091 ACAAGGAAAGAAACCCCAAAAGG - Intergenic
1199832494 X:151560081-151560103 ACAAGCAAAGAAATCTCCAAAGG - Intergenic
1200695050 Y:6351304-6351326 ACAAGCAAAGAAATCTACAGAGG - Intergenic
1200711196 Y:6486412-6486434 ACAAGCAAAGAAATCTGCAAAGG + Intergenic
1200776143 Y:7171923-7171945 ACAAGCAAAGAAATCTCCAAGGG + Intergenic
1200801101 Y:7387735-7387757 ATAAGCAAAGAAATATCTAAAGG - Intergenic
1200880879 Y:8210257-8210279 ACAAGCAGAGAAATCCCCAAAGG - Intergenic
1200959233 Y:8982002-8982024 ATAAGCAAAGAAATCTCCAAAGG + Intergenic
1200966690 Y:9045419-9045441 ACAAGAAAAGAAATCTCCAAAGG + Intergenic
1201022740 Y:9675574-9675596 ACAAGCAAAGAAATCTGCAAAGG - Intergenic
1201040227 Y:9823406-9823428 ACAAGCAAAGAAATCTACAGAGG + Intergenic
1201272000 Y:12264566-12264588 ACAAGCAAACAAATCTCCAAAGG - Intergenic
1201312132 Y:12606585-12606607 GAAAACAAAGAAATCTCCAAAGG - Intergenic
1201403692 Y:13629943-13629965 ATAAGCAAAGAAATATCCAAAGG + Intergenic
1201407587 Y:13664217-13664239 GCAAGCAAAGAAATCTCCAAGGG - Intergenic
1201429613 Y:13891083-13891105 ATAAGCAAAGAAATCTCCAAAGG + Intergenic
1201468754 Y:14312370-14312392 ATAAGCAAAGAAATCTCCAAAGG + Intergenic
1201487497 Y:14508454-14508476 ATAAGCAAAGAAATCTCTAAAGG + Intergenic
1201496483 Y:14595265-14595287 ACAAGCAAAGAAATCTCCAAAGG - Intronic
1201516055 Y:14819575-14819597 ACAAGCAAAGAAATATCCAAGGG - Intronic
1201555651 Y:15262856-15262878 ATAAGCAAAGAAATCTCCAAAGG + Intergenic
1201568655 Y:15391692-15391714 ATAAGCAAAGAAATATCCAAAGG - Intergenic
1201604645 Y:15771588-15771610 ACAAGGAAATAAATCTCGAAGGG + Intergenic
1201631180 Y:16073390-16073412 ATAAGCAAAGAAATCTCCAAAGG + Intergenic
1201648969 Y:16264768-16264790 ACAAGCAAAGAAATCCCCAAAGG - Intergenic
1201653840 Y:16320532-16320554 ACAAGCAAAGAAATCCCCAAAGG + Intergenic
1201729662 Y:17190512-17190534 ATAAGCAAAGAAATCTCCAAGGG - Intergenic
1201744064 Y:17351810-17351832 ATAAGCAAAGAAATCTCCAAGGG - Intergenic
1201785345 Y:17771172-17771194 ACAGGCAAATAAATGTCCCAAGG - Intergenic
1201816208 Y:18134815-18134837 ACAGGCAAATAAATGTCCCAAGG + Intergenic
1201908293 Y:19107124-19107146 ACAAGCAAAGGAATCTCCAACGG - Intergenic
1201911028 Y:19133660-19133682 ACAAGCAAAGAAATCCCCAGGGG + Intergenic
1201989594 Y:20009353-20009375 ACAAGGAAATAAATCTCCAAGGG - Intergenic
1202074779 Y:21026966-21026988 ATAAGCAAAGAAATCTCCAAAGG - Intergenic
1202089942 Y:21178885-21178907 ACAAGAAAAGAAATCTCCAAAGG - Intergenic
1202192691 Y:22260725-22260747 ACAAGCAAAGAAATCCCCAAAGG - Intergenic
1202242803 Y:22788287-22788309 ATAAGCAAAGAAATCTCCAAAGG + Intergenic
1202257746 Y:22939142-22939164 ACAAGCAAAGAAATCTCCAAAGG + Intergenic
1202272142 Y:23082795-23082817 ATAAGCAAAGAAATCTCCAGAGG - Intergenic
1202293884 Y:23337887-23337909 ATAAGCAAAGAAATCTCCAGAGG + Intergenic
1202395790 Y:24422037-24422059 ATAAGCAAAGAAATCTCCAAAGG + Intergenic
1202410736 Y:24572889-24572911 ACAAGCAAAGAAATCTCCAAAGG + Intergenic
1202425139 Y:24716539-24716561 ATAAGCAAAGAAATCTCCAGAGG - Intergenic
1202445650 Y:24953546-24953568 ATAAGCAAAGAAATCTCCAGAGG + Intergenic
1202460045 Y:25097183-25097205 ACAAGCAAAGAAATCTCCAAAGG - Intergenic
1202474995 Y:25248055-25248077 ATAAGCAAAGAAATCTCCAAAGG - Intergenic