ID: 1069137386

View in Genome Browser
Species Human (GRCh38)
Location 10:64782692-64782714
Sequence TTGCTTGTTTCCTTCTGGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069137383_1069137386 -8 Left 1069137383 10:64782677-64782699 CCTTTGGAGATTTCTTTGCTTGT No data
Right 1069137386 10:64782692-64782714 TTGCTTGTTTCCTTCTGGGCAGG No data
1069137381_1069137386 9 Left 1069137381 10:64782660-64782682 CCAGGGGTTTTTGTGGTCCTTTG No data
Right 1069137386 10:64782692-64782714 TTGCTTGTTTCCTTCTGGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069137386 Original CRISPR TTGCTTGTTTCCTTCTGGGC AGG Intergenic