ID: 1069137389

View in Genome Browser
Species Human (GRCh38)
Location 10:64782702-64782724
Sequence TCTAATCTCCCCTGCCCAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 488
Summary {0: 90, 1: 51, 2: 73, 3: 48, 4: 226}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069137389_1069137396 12 Left 1069137389 10:64782702-64782724 CCTTCTGGGCAGGGGAGATTAGA 0: 90
1: 51
2: 73
3: 48
4: 226
Right 1069137396 10:64782737-64782759 CTAATAGGAAGGGGAGCTATAGG No data
1069137389_1069137392 -3 Left 1069137389 10:64782702-64782724 CCTTCTGGGCAGGGGAGATTAGA 0: 90
1: 51
2: 73
3: 48
4: 226
Right 1069137392 10:64782722-64782744 AGAGGAGGCTTATCACTAATAGG No data
1069137389_1069137399 21 Left 1069137389 10:64782702-64782724 CCTTCTGGGCAGGGGAGATTAGA 0: 90
1: 51
2: 73
3: 48
4: 226
Right 1069137399 10:64782746-64782768 AGGGGAGCTATAGGGAGGCTAGG 0: 108
1: 90
2: 39
3: 32
4: 231
1069137389_1069137400 28 Left 1069137389 10:64782702-64782724 CCTTCTGGGCAGGGGAGATTAGA 0: 90
1: 51
2: 73
3: 48
4: 226
Right 1069137400 10:64782753-64782775 CTATAGGGAGGCTAGGATATTGG 0: 94
1: 70
2: 25
3: 10
4: 88
1069137389_1069137394 2 Left 1069137389 10:64782702-64782724 CCTTCTGGGCAGGGGAGATTAGA 0: 90
1: 51
2: 73
3: 48
4: 226
Right 1069137394 10:64782727-64782749 AGGCTTATCACTAATAGGAAGGG No data
1069137389_1069137395 3 Left 1069137389 10:64782702-64782724 CCTTCTGGGCAGGGGAGATTAGA 0: 90
1: 51
2: 73
3: 48
4: 226
Right 1069137395 10:64782728-64782750 GGCTTATCACTAATAGGAAGGGG No data
1069137389_1069137393 1 Left 1069137389 10:64782702-64782724 CCTTCTGGGCAGGGGAGATTAGA 0: 90
1: 51
2: 73
3: 48
4: 226
Right 1069137393 10:64782726-64782748 GAGGCTTATCACTAATAGGAAGG No data
1069137389_1069137402 30 Left 1069137389 10:64782702-64782724 CCTTCTGGGCAGGGGAGATTAGA 0: 90
1: 51
2: 73
3: 48
4: 226
Right 1069137402 10:64782755-64782777 ATAGGGAGGCTAGGATATTGGGG No data
1069137389_1069137398 16 Left 1069137389 10:64782702-64782724 CCTTCTGGGCAGGGGAGATTAGA 0: 90
1: 51
2: 73
3: 48
4: 226
Right 1069137398 10:64782741-64782763 TAGGAAGGGGAGCTATAGGGAGG 0: 105
1: 83
2: 42
3: 43
4: 263
1069137389_1069137397 13 Left 1069137389 10:64782702-64782724 CCTTCTGGGCAGGGGAGATTAGA 0: 90
1: 51
2: 73
3: 48
4: 226
Right 1069137397 10:64782738-64782760 TAATAGGAAGGGGAGCTATAGGG 0: 108
1: 82
2: 38
3: 19
4: 140
1069137389_1069137401 29 Left 1069137389 10:64782702-64782724 CCTTCTGGGCAGGGGAGATTAGA 0: 90
1: 51
2: 73
3: 48
4: 226
Right 1069137401 10:64782754-64782776 TATAGGGAGGCTAGGATATTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069137389 Original CRISPR TCTAATCTCCCCTGCCCAGA AGG (reversed) Intergenic
900719852 1:4168603-4168625 TATTATCTCACCTGCCCAGGAGG + Intergenic
900920396 1:5666586-5666608 TCTTAAATCCCCTGCCCAGAAGG + Intergenic
902430937 1:16362543-16362565 TCTAATCTCAGCTACTCAGAAGG + Intronic
902461207 1:16578467-16578489 TGTAATCACCCCTGCTCAGGAGG - Intronic
902461989 1:16584763-16584785 TGTAATCACCCCTGCTCAGGAGG - Intronic
903736967 1:25536064-25536086 TCTAGACTCCACTGCACAGACGG + Intergenic
903987969 1:27242806-27242828 TGTCTTCTCCCCTGCCCAGTGGG - Intronic
904188978 1:28728738-28728760 TGTAATCTCAGCTACCCAGAAGG + Intergenic
904884337 1:33725155-33725177 TCTAAGCTCCCATGACCTGAGGG + Intronic
906652273 1:47521298-47521320 TTTGCTCTCCCCTGGCCAGAAGG + Intergenic
906747785 1:48233811-48233833 TCCAATCTCCACTGCCCAGGAGG + Intronic
906766621 1:48440107-48440129 TCTAATCTCCCCCACCCAGAAGG + Intronic
908300352 1:62756378-62756400 TCTAATCTCCCCTGCCCAGAAGG + Intergenic
908514976 1:64883316-64883338 TGTACTCTCCACTGCCCAGCCGG + Exonic
908659818 1:66423977-66423999 TCTAATCTCCCCCACCCAGAAGG - Intergenic
909359472 1:74744091-74744113 TCTAATCTCCCCCTCCCAGAAGG - Intronic
911129830 1:94376701-94376723 TCTAATCTCCCCAACCCAGAAGG - Intergenic
911298913 1:96150028-96150050 TCTAATCTCCCTTGCCCAGAAGG + Intergenic
911751355 1:101500990-101501012 TCTAATCTCCCCCACCCAGAAGG + Intergenic
911845681 1:102747987-102748009 TCTAATCTCCCCTGCCCAGAAGG - Intergenic
912021241 1:105111139-105111161 TCTACTCTCCCCTGCCCAGAGGG + Intergenic
912867066 1:113267103-113267125 TCAAATGTCCCCTCCTCAGAGGG + Intergenic
913382560 1:118227652-118227674 TCTAATCTCCCCCACCAAGAAGG + Intergenic
913469458 1:119174414-119174436 TCTAATCTCCCCTGCCCAGAAGG + Intergenic
913604211 1:120450103-120450125 TGTAATCACCCCTGCTCAGGAGG + Intergenic
913641086 1:120812799-120812821 TGTAATCACCCCTGCTCAGGAGG + Intronic
914084327 1:144439103-144439125 TGTAATCACCCCTGCCTAGGAGG - Intronic
914277397 1:146137510-146137532 TGTAATCACCCCTGCTCAGGAGG - Intronic
914365409 1:146973664-146973686 TGTAATCACCCCTGCTCAGGAGG + Intronic
914487037 1:148119775-148119797 TGTAATCACCCCTGCTCAGGAGG - Intronic
914538445 1:148588458-148588480 TGTAATCACCCCTGCTCAGGAGG - Intronic
914587373 1:149074931-149074953 TGTAATCACCCCTGCTCAGGAGG - Intronic
915260506 1:154673606-154673628 TCTAATCTCCCCTGCCCAGAAGG + Intergenic
915500299 1:156311327-156311349 AATAATCTGCCCTGCCCAGTAGG - Intronic
915508083 1:156369870-156369892 TCTTACCTTCCCTGCCCAGCAGG - Intronic
915991462 1:160521342-160521364 TCCAATCTCCACTTCACAGATGG - Intronic
916083568 1:161252248-161252270 TCTAATCTCCCCTATCCAGAAGG + Intergenic
916114377 1:161474684-161474706 TTTGATCTCCCCTGCCCAGAAGG + Intergenic
917086071 1:171306969-171306991 TCTAATCTCCCCTACCCAGAAGG + Intergenic
917279825 1:173369967-173369989 TCTAATCTCCTCCACCCAGAAGG + Intergenic
917281092 1:173378813-173378835 GCTAATCTCCCCCGCCCATAAGG + Intergenic
917445860 1:175105399-175105421 TCTAATCTCCCCTGCCCAGAAGG - Intronic
917676219 1:177321733-177321755 TCTAATCTCCCCTGCCCAAAAGG + Intergenic
918750232 1:188261611-188261633 TTTAATCTCCCCTGCCTAGAAGG - Intergenic
919206233 1:194424114-194424136 TTTAATCTCCCTCACCCAGAAGG + Intergenic
919558592 1:199092375-199092397 ACTAATGTCCCCCACCCAGAAGG + Intergenic
919991504 1:202710701-202710723 TCTATACTCCCCACCCCAGAAGG + Intergenic
921019642 1:211224304-211224326 TCTAATCTCCCCCACCCAGAAGG + Intergenic
921051468 1:211514877-211514899 TCTTATTTCCTCTGCCCAGGTGG + Intergenic
921253754 1:213321072-213321094 TCTAATATCACCTGCCAATATGG - Intergenic
922079659 1:222283591-222283613 TATAATCTCCCCTCCCAAGAAGG + Intergenic
923430374 1:233914130-233914152 TCTAATCTACACGGCCCAGGAGG - Intronic
924039495 1:239970797-239970819 TCTGAACTCCCATGCCAAGAGGG + Intergenic
1063321762 10:5058118-5058140 TCTAACCTCCCCCGCCCAGAAGG - Intronic
1063414740 10:5864280-5864302 TCTAACCTCCCCTGCCCAGAAGG + Intronic
1063859145 10:10289602-10289624 TCTAATCTCCCCCACCCAGAAGG - Intergenic
1063976733 10:11423557-11423579 TCCAACATTCCCTGCCCAGAAGG - Intergenic
1064175994 10:13075596-13075618 TCTTGTCTCCCCTCCCCACAAGG - Intronic
1064603622 10:17016728-17016750 TCTAATCTCCCCCACCCAGAAGG - Intronic
1065082354 10:22140913-22140935 TCTAATCTCCCCCACCCAGAAGG + Intergenic
1065424517 10:25585855-25585877 TGTAATCTCTGCTGCTCAGATGG + Intronic
1066117637 10:32254389-32254411 TGTAATCTCAGCTACCCAGAAGG - Intergenic
1066259731 10:33717758-33717780 TGTAATCTCAGCTGCTCAGAAGG + Intergenic
1066651872 10:37664145-37664167 TCTTATTTCCCCTTACCAGATGG + Intergenic
1067035636 10:42914455-42914477 TCTTATTTCCCCTTACCAGATGG + Intergenic
1068240597 10:54297591-54297613 TCTAATCTCCCTTGCCCAGAGGG + Intronic
1068500256 10:57834797-57834819 TCTAATTTCCCCTGCCCAGAAGG + Intergenic
1069137389 10:64782702-64782724 TCTAATCTCCCCTGCCCAGAAGG - Intergenic
1069238491 10:66108437-66108459 TCTGAGCTCCCATGCCGAGAAGG - Intronic
1069365141 10:67688318-67688340 TCTAATCTCCCCCACCCAGAAGG - Intronic
1070449792 10:76546634-76546656 TCTGGTTTCCCCTGCCTAGAAGG + Intronic
1071834805 10:89408481-89408503 TCTAATCTTCCCTGCCCAGAAGG + Intronic
1072044622 10:91642562-91642584 TCAGATGTCACCTGCCCAGATGG + Intergenic
1072371709 10:94771260-94771282 TCTAATCTCCCCTTCCCAGAAGG - Intronic
1074357618 10:112799878-112799900 TCTAGTCCCCCCAGCCCAGGTGG - Intronic
1074612985 10:115039161-115039183 TCTAATCTCCCCCACCCAGAAGG + Intergenic
1074742697 10:116500328-116500350 TCTAATCTCCCCCTCCCAGAAGG - Intergenic
1076946706 10:133656561-133656583 TCTACTCTCTGCAGCCCAGATGG - Intergenic
1077607043 11:3619270-3619292 TTTAATCTCCCCTACTCAGGAGG + Intergenic
1079491474 11:20993303-20993325 TATAGTATCCCCTGCCCACAAGG - Intronic
1079731274 11:23939473-23939495 TCTAATCTCCCCTGCCCAGAAGG - Intergenic
1079811708 11:25005194-25005216 TCTAATCTCCCCAGCCCAGAAGG - Intronic
1081033380 11:38113598-38113620 TCTAATCTCCCCCACCCAGAAGG + Intergenic
1081145954 11:39562803-39562825 TCTAATCTCCCCTGCCCAGAAGG + Intergenic
1081421374 11:42877080-42877102 TCTAATCTCCCCTGCCCAGAAGG + Intergenic
1081642756 11:44767545-44767567 TTTTATCTCCCCTGCCCATAGGG + Intronic
1082906184 11:58310577-58310599 TCTAATCCCCCCCACACAGAAGG - Intergenic
1083644333 11:64164006-64164028 TCTGATCTCCCCAGCTCAGGTGG + Intronic
1084210953 11:67622138-67622160 TCTAATCTCCCCTGCCCAGAAGG + Intergenic
1086317341 11:85608601-85608623 TCTAATCTCCCCGGCCCAGAAGG + Intronic
1087074955 11:94120288-94120310 TCTAATCTCCCCCACCCAGAAGG + Intergenic
1087319216 11:96638499-96638521 TCTAATCTCCCCTACCAAGAAGG + Intergenic
1087459044 11:98422889-98422911 TCTAATCTCCCCTGCCTAGAAGG - Intergenic
1087683377 11:101238561-101238583 TCTAATCTCCCCTGCCCAGAAGG - Intergenic
1088492498 11:110401490-110401512 TCTAATCTCCCCTGCTCAGAAGG + Intergenic
1089302855 11:117509031-117509053 TCTACTTTCCCCAGCCCACACGG - Intronic
1090071946 11:123551471-123551493 TGTCATCTCCCCTTCACAGATGG + Intronic
1090199849 11:124846254-124846276 GCCAATCTCCCAGGCCCAGATGG + Intergenic
1090229989 11:125095253-125095275 TCTACTGTTCCCTACCCAGAGGG - Intergenic
1091573956 12:1715068-1715090 TCTAATCTCCACCACCCAGAAGG - Intronic
1092472254 12:8790377-8790399 TCTAATCTCCCCTGCCCAGAAGG + Intergenic
1092957284 12:13562501-13562523 TCTACCCTCCCCTGCTGAGAGGG + Exonic
1092991268 12:13902687-13902709 TGTAATCTCACCTACTCAGAAGG + Intronic
1094047706 12:26185523-26185545 TCTTTTCTCCCCTGCCCAGGGGG - Intronic
1094320010 12:29173311-29173333 TCTAATCTCCCCTGGCCAGAAGG - Intronic
1094338150 12:29383650-29383672 TCTAATCTCCCCTGGCCAGAAGG - Intergenic
1097016141 12:55988623-55988645 TGTAATCTCCGCTGCTCAGGAGG - Intronic
1097428258 12:59472971-59472993 TCTAATCTCCCCTGCCCAGAGGG + Intergenic
1097888273 12:64751864-64751886 TGTAATCTCAGCTACCCAGAAGG + Intronic
1099376210 12:81898539-81898561 TCTAATCTCCCCTGCCCAGAAGG + Intergenic
1099414782 12:82372353-82372375 TCTAATCTCCCCTGCCCAGAAGG - Intronic
1099576903 12:84393501-84393523 TCTAATCTCCCCTGCCCAGAGGG - Intergenic
1100050816 12:90446270-90446292 TCTAATCTCCCCTGCCTATAAGG - Intergenic
1100092103 12:90984751-90984773 TCTAATCTCCTCCACCCAGAAGG + Intronic
1100530275 12:95455896-95455918 TCTAACTTCCCCCACCCAGAAGG - Intergenic
1101268851 12:103121518-103121540 TCTATTCTTCCATGCCCAAATGG - Intergenic
1101704839 12:107211955-107211977 TCTAATCTTCCCCACCCAGAAGG + Intergenic
1101779619 12:107823824-107823846 TCTAATCTCCCCGGCCCAGAAGG + Intergenic
1104159310 12:126163344-126163366 TCCAATCACACCTTCCCAGAGGG + Intergenic
1104405493 12:128513139-128513161 TATCATGTCCCCTCCCCAGAGGG - Intronic
1104414567 12:128587354-128587376 TCGAATCTCATCTGGCCAGAGGG + Intronic
1104767056 12:131336960-131336982 TCTAATCTCCCCCACCCAGAAGG + Intergenic
1104963098 12:132497528-132497550 TCCATACTCCCCTACCCAGATGG + Intronic
1105762438 13:23526938-23526960 TCTAATCTCCCCTGCCCAGAAGG + Intergenic
1106162651 13:27214822-27214844 TCTAATCTCCCCTACCAAGAAGG + Intergenic
1107469674 13:40680574-40680596 TCCAATCACACCTGCCCAGTAGG - Intergenic
1108379020 13:49839341-49839363 TCTACTGTCCCCTGCCCACCTGG + Intergenic
1108848559 13:54702346-54702368 TCTAATCTCCCCTGCCCAGAAGG + Intergenic
1109424261 13:62150902-62150924 TCTAATCTCCCCAACCCAGAAGG + Intergenic
1110828701 13:80004665-80004687 TCTAATCACCCCTACTCAGGAGG + Intergenic
1111372488 13:87335621-87335643 TCTAATCTCCCCCACCCAGAAGG + Intergenic
1112519076 13:100080381-100080403 TCTAATCTCCCCTGCCCAGAAGG + Intergenic
1113203966 13:107895210-107895232 TCTAATCTCCCCTGCCCAAAAGG - Intergenic
1113263916 13:108595346-108595368 TCAAATCTCCCCACCCCACATGG + Intergenic
1113551547 13:111196666-111196688 TCTAATCTCCCCTGCCCAGAAGG - Intronic
1114266372 14:21074776-21074798 TCTAAGCTCCCCTGGCCTCAGGG - Exonic
1114632275 14:24166753-24166775 CCTAATCTTATCTGCCCAGAGGG - Exonic
1114711185 14:24780051-24780073 CCTAGTCTCCTTTGCCCAGAAGG + Intergenic
1115285501 14:31709833-31709855 TCTAATCTCCCCTGCCCAGAAGG - Intronic
1115462259 14:33674557-33674579 TGTAATCCCCCCCTCCCAGAGGG + Intronic
1116899844 14:50350900-50350922 TCCATTCTGCCCTCCCCAGAAGG - Intronic
1117064181 14:51992906-51992928 TGTAATCTCAGCTGCCCAGGGGG + Intronic
1117247905 14:53904082-53904104 TCTATGCTTCTCTGCCCAGAAGG + Intergenic
1117485383 14:56191645-56191667 TCTAATCTCACAGGCTCAGAAGG - Intronic
1118388217 14:65274425-65274447 TCTGATCTCCCCTCTCCAGAAGG - Intergenic
1118852896 14:69598242-69598264 TGTAATCTCAGCTACCCAGAAGG - Intergenic
1119259990 14:73232312-73232334 TCTCATCCCCTCTGCCCACAGGG - Intergenic
1119840074 14:77785781-77785803 TCCATTGCCCCCTGCCCAGAAGG - Intergenic
1120198748 14:81515100-81515122 TCTAATCTCCCCTGCCCAGAAGG + Intronic
1121801119 14:96774979-96775001 CCTAATCTCCCCTTCCCATAAGG + Intergenic
1121928801 14:97953271-97953293 TGTGATCTCCCCTGTCTAGATGG + Intronic
1124516433 15:30370593-30370615 TCCAACCTTCCCTGCCCAGTGGG + Intronic
1124726485 15:32160138-32160160 TCCAACCTTCCCTGCCCAGTGGG - Intronic
1126072115 15:44874312-44874334 TCTAATCTCCCCCACCCAGAAGG - Intergenic
1126086075 15:45012357-45012379 TCTAATCTCCCCCACCCAGAAGG + Intergenic
1131732356 15:95295488-95295510 TCTGAAATCCACTGCCCAGAGGG - Intergenic
1132814167 16:1818005-1818027 TCCCATCTCTCGTGCCCAGAAGG - Intronic
1132925332 16:2426330-2426352 TCTAGAATCCCCTGCCCAGATGG + Intergenic
1133582071 16:7154334-7154356 TCTAATCTCCCAGGCAGAGATGG - Intronic
1134913923 16:18053315-18053337 TCTAATCTCCCCTTCTTACAAGG + Intergenic
1135300581 16:21323223-21323245 TCTAATCTCCCTTTCTCAGGGGG - Intergenic
1135339719 16:21635348-21635370 TCTAATCTCCCCTGCCCAGAAGG - Intronic
1135709956 16:24707935-24707957 TGTAATCTCAACTGCTCAGAAGG + Intergenic
1136076674 16:27822045-27822067 TCTTATTTGCCCTGCACAGAGGG + Intronic
1139355458 16:66364737-66364759 TCTGCTTTCTCCTGCCCAGAGGG - Intergenic
1142033261 16:87848869-87848891 TGTAATCACCCCTTCCCAGTTGG - Intronic
1142215621 16:88828464-88828486 TAAAGCCTCCCCTGCCCAGAGGG + Intronic
1142625235 17:1187514-1187536 TCTGCTCTCTCCTTCCCAGACGG - Intronic
1143001626 17:3798465-3798487 TCCTATCCCCCCTGCACAGAAGG + Intronic
1145804057 17:27713913-27713935 TCTAACCTCCCCCACCCAGAAGG + Intergenic
1146422701 17:32703535-32703557 TGTAATCTCACCTACCCAGGAGG - Intronic
1147367062 17:39965985-39966007 TCTAATCACCTCTGGCCAGAGGG - Intronic
1147609871 17:41795319-41795341 TGTAGTCTCACCTGCTCAGAAGG + Intergenic
1149073850 17:52575273-52575295 TCTAATCTCCCCCACCCAGAAGG + Intergenic
1149209620 17:54288332-54288354 TCTAATCTCCCCCACCCAGAAGG + Intergenic
1149647999 17:58254436-58254458 TCGAAGCTCCCCTTCCTAGAAGG + Intronic
1151567965 17:74910451-74910473 GCTAATCTCCCCTGCCCAGAAGG + Intergenic
1152146868 17:78573666-78573688 TCTAATCTCCCCTCCTCGTAAGG - Intronic
1153438003 18:5087551-5087573 CCTAATCTCCCCCACCCAGAAGG + Intergenic
1154531906 18:15354781-15354803 TCTAATCCCACCTGCTCAGGAGG + Intergenic
1155378552 18:25190000-25190022 TCTCATCTCTCCTGTACAGATGG + Intronic
1155476167 18:26237526-26237548 TCTAATCTCCCCCACCCAGAAGG - Intronic
1155572426 18:27210530-27210552 TCCAATCTCCCCTGCCTTTATGG + Intergenic
1156889955 18:42179310-42179332 TCTAATCACCCCTAATCAGAGGG - Intergenic
1157155251 18:45259169-45259191 TCTCCTCTCTCCTGCTCAGAGGG + Intronic
1157427339 18:47595234-47595256 TCTAAGCTGCCCAGCCAAGAAGG - Intergenic
1157857947 18:51118395-51118417 TCTAATCTCCCCTGCCCAGAAGG - Intergenic
1157874827 18:51262493-51262515 TATAATCTTCCCTTACCAGAGGG - Intergenic
1159634473 18:70788600-70788622 TCGAATCTCCTCTTCTCAGAAGG + Intergenic
1160747083 19:717049-717071 TGTAATCTCCGCTGCTCAGGAGG - Intronic
1161598285 19:5163827-5163849 TCTAATCTCCCCCACCCAGAAGG - Intronic
1162107870 19:8381564-8381586 TCTAATCTCCCCTGCCCAGAAGG + Intronic
1162238514 19:9327367-9327389 TCTAATCCCAGCTACCCAGAAGG - Intronic
1162356199 19:10186519-10186541 TCTTATCTCCCCTCTGCAGAGGG - Intronic
1162815753 19:13193308-13193330 TGTAATCTCAGCTACCCAGAAGG + Intergenic
1163772301 19:19198469-19198491 TCTGATTTCCCTTGCCCACATGG - Intronic
1164992996 19:32698000-32698022 TCTAATGTCCGCTGCCCAGAAGG - Intronic
1165029672 19:32988700-32988722 TGTAAGTGCCCCTGCCCAGAAGG + Intronic
1165847031 19:38824818-38824840 TCTAATCTCCCCTGCCCAGAAGG + Intronic
1167007643 19:46786450-46786472 GCTAATCTCCCCCAGCCAGAAGG + Intronic
1167716877 19:51147698-51147720 TCTTGTGTCCCCTGCCCTGATGG + Intronic
1167815324 19:51875740-51875762 TTTGATGGCCCCTGCCCAGAGGG + Intronic
925783828 2:7408803-7408825 TCTTATCTCCACTGGGCAGATGG + Intergenic
925949948 2:8900609-8900631 TCTAATCTCCCCCACTCAGAAGG - Intronic
926843405 2:17107095-17107117 TCTAGTCTCCACTGCCCTGAAGG - Intergenic
928617680 2:33055886-33055908 TCTCATCTCCCCTGCCCAGAAGG - Intronic
929154009 2:38773298-38773320 TGTAATCTGCCCTGCCCAGAGGG - Intronic
929668739 2:43853081-43853103 TCTAATCTATCATGCACAGAAGG - Intronic
930038467 2:47102675-47102697 TCTAATCTCCCCTGCCCAGAAGG + Intronic
931298360 2:60952210-60952232 TATAATCTCCGCTACCCAGGAGG + Intronic
931540432 2:63324339-63324361 TCTAATCTCCCCTGCCCAGAAGG + Intronic
933342098 2:81037352-81037374 TCTAATCTCCCCTGCCCAGAAGG + Intergenic
933582625 2:84144589-84144611 TCCATCCTCCCCTCCCCAGAAGG + Intergenic
934867065 2:97823194-97823216 TCTAATTTCCCCCACCCAGAAGG + Intronic
934945386 2:98537530-98537552 TGTGCTCACCCCTGCCCAGAGGG - Intronic
937820655 2:126306979-126307001 TCTCATCTCCTCTTCCCATAAGG + Intergenic
938806244 2:134809309-134809331 TCTAATCTCCCCCGCCCAGAAGG - Intergenic
939851801 2:147313479-147313501 TCTAATATCCCCTGCCCAGAAGG + Intergenic
940431950 2:153602468-153602490 TCAAATCACCCCTTCCCAGTAGG - Intergenic
941006849 2:160257092-160257114 TCTCAGCTCCCCAGCCAAGATGG + Intronic
941243357 2:163068853-163068875 TCTAATCTCCCCTGCCCAGAAGG + Intergenic
941537604 2:166742067-166742089 TCTAATCTCCTCTGCCCAGAAGG - Intergenic
941933280 2:170963602-170963624 TCTCATCACCCCTGCTCAGCTGG + Intronic
942544614 2:177050215-177050237 TCTAATCGTCTCTGGCCAGAGGG - Intergenic
943103132 2:183510848-183510870 TTTAATCTCCCCCACCCAGAAGG - Intergenic
944728939 2:202499009-202499031 TCTAATCTCCCCTGCCCAGAAGG + Intronic
945503250 2:210604962-210604984 TCCATTCTCCCCTGCACAGAAGG - Intronic
945520072 2:210815998-210816020 TGTAATCTCAGCTGCTCAGAAGG - Intergenic
946113090 2:217437392-217437414 TCTTACCTCCCCTGCCCCAAGGG - Intronic
946207413 2:218119840-218119862 TCTAATCTCCCTTGCCCAGAAGG - Intergenic
946617302 2:221523713-221523735 TGTAATCTCAGCTACCCAGAAGG - Intronic
947716523 2:232341977-232341999 TCCCATCAGCCCTGCCCAGATGG + Intronic
947950826 2:234145687-234145709 TCTCTTCCCCACTGCCCAGATGG - Intergenic
948137529 2:235647907-235647929 TCTGCTCTCACCTGGCCAGAGGG - Intronic
1169769221 20:9183083-9183105 TGAAATCTCCCCTGCCCCGGAGG + Intronic
1170781396 20:19428799-19428821 TTTAACCTGCCCTGCCCAGGAGG + Intronic
1171261454 20:23738022-23738044 TCTAATCTCACCAGCTCAGAAGG + Intergenic
1171270590 20:23813913-23813935 TCTAATCTCCCCCACTGAGAAGG + Intergenic
1171751175 20:29050601-29050623 TGTAATCTCAGCTCCCCAGACGG + Intergenic
1171816314 20:29788722-29788744 TCTTAAATCCCCTGCCCGGAAGG - Intergenic
1172189411 20:33053210-33053232 GACAATCTCCCCTGCCCTGAAGG - Intergenic
1172340592 20:34154526-34154548 TCTAATCTCCCCCACCAAGAAGG + Intergenic
1174373447 20:50110014-50110036 ACTAATCTCTGCTGCCCACATGG + Intronic
1174550016 20:51355459-51355481 TCAAATGTCCCCTCCCCAGAGGG + Intergenic
1174667007 20:52267908-52267930 TGTAATCCCACCTGCTCAGAAGG - Intergenic
1175359395 20:58396382-58396404 CCTAGTCTCCACTTCCCAGATGG - Intronic
1176765457 21:13013401-13013423 TCTAATCCCACCTGCTCAGGAGG - Intergenic
1177135006 21:17298885-17298907 TCTAATCTCCCCCACTGAGATGG + Intergenic
1177263874 21:18759584-18759606 TCCAATGTCCCCAACCCAGAAGG + Intergenic
1177901951 21:26927400-26927422 TCAAATATCACCTCCCCAGATGG - Intronic
1179728309 21:43353338-43353360 TCAAATCTCCCCTTCTCGGAAGG - Intergenic
1180319756 22:11309240-11309262 TCTTAAATCCCCTGCACAGAAGG - Intergenic
1180512647 22:16108201-16108223 TCTAATCCCACCTGCTCAGGAGG - Intergenic
1182045170 22:27268558-27268580 TCTAGACTACCCTGCCCACAGGG + Intergenic
1185393725 22:50576492-50576514 TCCAACCTCCCCTGCCCACTGGG + Intronic
949449028 3:4165424-4165446 TTTAATCTCCCCCACCCAGAAGG - Intronic
951020428 3:17776564-17776586 TCTAATCTCCCCCACCCAGAAGG + Intronic
951239406 3:20271775-20271797 TCTAATCTCCCCCGCCCAGAAGG + Intergenic
952147253 3:30547193-30547215 TCTAATCTCCCATCCCCTCATGG - Intergenic
952198183 3:31097964-31097986 AATAATCTCCTCTGGCCAGAAGG + Intergenic
952452966 3:33448740-33448762 TCTAATCTCCCCTGCCCAGAAGG + Intergenic
952555109 3:34522209-34522231 TCTAATCTCCCCCACCCAGAAGG - Intergenic
952941007 3:38444353-38444375 TCTAATCTTCTCTGCCCAGAAGG - Intergenic
953623003 3:44548810-44548832 TCTAATCTCCCCAGCCAAGAAGG - Intergenic
953688264 3:45095053-45095075 TATAATCTCAGCTGCTCAGAAGG - Intronic
954371663 3:50172154-50172176 TCTCATCTCCCCTCCCCAGCTGG - Intronic
954586924 3:51744417-51744439 TCTAATCTTCCCTACCCAGAAGG + Intergenic
954598865 3:51852262-51852284 TCTAATCTCCCCCACCCAGAAGG + Intergenic
954697655 3:52436186-52436208 CCTATTCTCCCCTTCCCAGGAGG + Intronic
955256334 3:57336101-57336123 TCTAATCTCAGCTACTCAGAAGG - Intronic
955596888 3:60600853-60600875 TCTAATTTGGTCTGCCCAGAGGG - Intronic
956081571 3:65562608-65562630 TGTAATCCCACCTCCCCAGAAGG - Intronic
956843022 3:73157405-73157427 TCTAATCTCCCCTGCCCAGAAGG - Intergenic
957672510 3:83323982-83324004 TCTACTCTCCCAAGCACAGAAGG + Intergenic
958549274 3:95593387-95593409 TCTAATCTCCCCTGCCCAGAAGG - Intergenic
958575871 3:95949482-95949504 TCTAATCTCCCCTGCCCAGAAGG - Intergenic
958601329 3:96299882-96299904 TCTAATCTCCCCCACCCAGAAGG + Intergenic
959634839 3:108554015-108554037 TGTAATCTCCGCTACCCAGAAGG - Intronic
960063627 3:113348623-113348645 TCTAATCTCCCCTGCCCAGAAGG + Intronic
963021193 3:140874445-140874467 TCTAATCTCCCCTGCCCAGAAGG + Intergenic
963409273 3:144907757-144907779 TCTAATCTCCCCTGCGCAGAAGG - Intergenic
963696684 3:148572930-148572952 TCTAATCTCCCCTGTCCAAAAGG + Intergenic
963992351 3:151668873-151668895 TCTAATCTCCCCTGCCCAGAAGG - Intergenic
964064433 3:152561917-152561939 TCTAATCTCCCCTGCCCAGAAGG + Intergenic
964972179 3:162576624-162576646 TCTAATCTCCCCCACCCAGATGG + Intergenic
965062683 3:163803683-163803705 TCTAATCTCCCCTACCCAGAAGG + Intergenic
965915948 3:173846035-173846057 TATAATCTCAGCTGCTCAGAAGG - Intronic
967583554 3:191187539-191187561 TCTAATCTCCCCTGCCCAGAAGG + Intergenic
967965811 3:194959504-194959526 TCTCATCTCCTCTGCCCATTTGG - Intergenic
968410771 4:387607-387629 CCTAATCTCCTCTGCCCTTATGG + Intergenic
970204266 4:13640426-13640448 GCTAATGTCTCCCGCCCAGAAGG - Intergenic
971281273 4:25244272-25244294 TCTAATCTCCCCTGCCCAGAAGG - Intronic
971578407 4:28305117-28305139 TCTAATCTCCCCTGCCCAGAAGG + Intergenic
972133372 4:35863092-35863114 TCTAATCTCCCCCACCCAGAAGG - Intergenic
973045801 4:45533557-45533579 TCTAATCTCCTCTGCCCATAAGG + Intergenic
973640033 4:52893552-52893574 AACAATCTCCCCTGCCCACATGG + Intronic
973754791 4:54064309-54064331 TCCGAGCTCCCCTGCCCAAAGGG + Exonic
974072725 4:57139918-57139940 TTTCCTCTGCCCTGCCCAGAAGG + Intergenic
974174427 4:58306459-58306481 GCTAATCTCCCCTTCCCAGAAGG + Intergenic
974187249 4:58460196-58460218 GCTAATCTCCCCTGCCCAGAAGG + Intergenic
974526488 4:63054952-63054974 TCTAATCTCCCCTGCCCAGAAGG + Intergenic
974537068 4:63186734-63186756 TCTAATCTCATCCACCCAGAAGG + Intergenic
974656899 4:64836888-64836910 TGTAATCTCACCTACCCGGAAGG - Intergenic
974838913 4:67280195-67280217 TCTAATCTCCCCTGCCCAGAAGG - Intergenic
975047929 4:69826942-69826964 TCTAATCTCCCCTTCCCAGAAGG + Intronic
975595912 4:76048077-76048099 TCTAATCTCCCCTGCCCAGAAGG - Intronic
976174382 4:82336933-82336955 TTTAATCTCCCCTACCCAGAAGG - Intergenic
978325656 4:107551105-107551127 TCAGATATCACCTGCCCAGAAGG - Intergenic
978394038 4:108258843-108258865 TCTAATGACTCCTGCACAGAGGG + Intergenic
978747111 4:112207555-112207577 TCTAATCTCCCCCACCCAGAAGG + Intergenic
980290964 4:130847108-130847130 TCTAATCTCCCCTGCCCAGAAGG - Intergenic
981074918 4:140581108-140581130 TATGATCTCCCATGCCCAGTGGG - Intergenic
981982557 4:150811622-150811644 TGTAATCTCACCTACTCAGAAGG - Intronic
982080607 4:151786080-151786102 TCTAATCTCCCCCAGGCAGATGG + Intergenic
982088087 4:151856396-151856418 TCAAATGTCCCCTGCTCAGAGGG - Intergenic
982220265 4:153118587-153118609 TGTAATCTCAGCTGCCCAGGAGG - Intergenic
982877231 4:160664457-160664479 TCTAATCTCCCCCACCCAGAAGG + Intergenic
983602709 4:169548650-169548672 TCAAAGATGCCCTGCCCAGAGGG + Intronic
983834994 4:172375065-172375087 TCTAATCTCCCCTGCCCAGAAGG - Intronic
984917378 4:184736541-184736563 TCTAATCTCCCCTATCCAGAAGG + Intergenic
985450162 4:190057360-190057382 TCTACTCTCTGCAGCCCAGATGG - Intergenic
987545312 5:19305215-19305237 TCCAATCTCCCCCACTCAGAAGG - Intergenic
988592086 5:32557756-32557778 TCTAATCTCCCCTGCCCAGAAGG - Intronic
988605568 5:32675876-32675898 TCTAATCTCCCCTGCCCAGAAGG - Intergenic
989496174 5:42113421-42113443 TCTAATCTCCCCTGCCCAGAAGG + Intergenic
989957278 5:50372446-50372468 TCTAATCTCCCCTGCCCAGAAGG + Intergenic
990367942 5:55089070-55089092 TCTAATCTCCCCCACCCAGAAGG - Intergenic
992022997 5:72643332-72643354 GCCTATCTCCCCTGCCCACAGGG - Intergenic
992049290 5:72928419-72928441 TCTAATCTTCCCTGCCCAGAAGG + Intergenic
992455129 5:76909605-76909627 TCTAATCTCCCCCGCCCAGAAGG + Intronic
992545703 5:77812119-77812141 TCTAACCTCCCCTGCCCGGAAGG + Intronic
994231807 5:97316159-97316181 TCTAATCTCCCCTGCCCAGAAGG - Intergenic
995583492 5:113623697-113623719 TCCAATCTCCCCTATCCAGAAGG - Intergenic
995706367 5:114992493-114992515 TCTAATCTCCCCCACCCAGAGGG + Intergenic
996099303 5:119430735-119430757 TCTAATCTCCCCTGCCCAGAAGG - Intergenic
996346019 5:122489415-122489437 TCTAATTTACTCTGCCCAGTTGG - Intergenic
996680308 5:126223408-126223430 TCAAATCTCCCCTGCCCAGAAGG + Intergenic
998111390 5:139505444-139505466 TCTAATCTCCCCTGCCCAGAAGG + Intergenic
998914992 5:147003255-147003277 TCTAATCTCCCCCACCCAGAAGG + Intronic
1000207584 5:159077151-159077173 TGTAATCCACCATGCCCAGAGGG - Intronic
1002898966 6:1394888-1394910 TCTCCTCTCCCCTCCTCAGAGGG + Exonic
1003805717 6:9724406-9724428 TCTAATCTCCCCTGCCCAGAAGG + Intronic
1004531290 6:16457800-16457822 TCTAATCTCCTCCATCCAGAAGG + Intronic
1004812165 6:19273325-19273347 TCTAATCTCCCCTGCCCAGAAGG + Intergenic
1004842119 6:19599097-19599119 TCTCATCTCCCTTGCCCTTATGG - Intergenic
1005196320 6:23288307-23288329 TCTGATCTCCACTGCACAGTAGG + Intergenic
1005764443 6:28997043-28997065 TCTAATCTGCCCCAACCAGATGG - Intronic
1006017228 6:31091509-31091531 TCTGGTCTCCCTTGACCAGAAGG + Intergenic
1006479806 6:34282990-34283012 TATAAGCTCCCCTCCCCAGGTGG + Exonic
1007402088 6:41608629-41608651 TCTAGGCTGCCCTTCCCAGAAGG - Intergenic
1008587073 6:52959937-52959959 TCTAATCTCCCCTGCCCAGAAGG - Intergenic
1009407784 6:63331118-63331140 TCTAATCTCCCCTGCCCAGAAGG - Intergenic
1009470727 6:64026733-64026755 TCTAATCTCCCCTGCCCAGAAGG + Intronic
1009718488 6:67431105-67431127 TCTAATAACTCCAGCCCAGATGG - Intergenic
1009872705 6:69470248-69470270 TCTAATCTCCCCTGCCCAGAAGG + Intergenic
1010074869 6:71787667-71787689 TGTAATCTCCCCTTCCCAGAAGG + Intergenic
1010269755 6:73905988-73906010 TCTAATCTCCCCTGCCCAGAAGG + Intergenic
1011375123 6:86679277-86679299 TCTAATCTCCCGTGCCCAGAAGG - Intergenic
1011590897 6:88969801-88969823 TCTATTCTGCCCTACCCAGCAGG + Intergenic
1012441632 6:99266701-99266723 TCTAATCTCCTCCACCCGGAAGG - Intergenic
1013907927 6:115239038-115239060 TCCAATCTCCCCTGCCCAGAAGG - Intergenic
1013977343 6:116093203-116093225 TCCAATCTCCCCTGCCCAGAAGG + Intergenic
1014026626 6:116655445-116655467 TCTAATTTGCCCTCCCCACAAGG - Intronic
1014231079 6:118903275-118903297 TCTACACACCCCTGCACAGAGGG - Intronic
1015584776 6:134764222-134764244 TCTTATCTCCTCCCCCCAGATGG + Intergenic
1015997390 6:139008598-139008620 TCTCCTCTCCTCTGCCCAAAGGG + Intergenic
1016183950 6:141178272-141178294 TCTAATCTCCCCTGCCCAGAAGG + Intergenic
1016890248 6:148998950-148998972 TCTCATCTCTACAGCCCAGAAGG - Intronic
1020289186 7:6709824-6709846 TCAAATCTCCCTTTCCCAGCTGG + Intergenic
1021158141 7:17237446-17237468 CCTAATCTCCCCAACCCAAAAGG + Intergenic
1021356655 7:19658933-19658955 TCTAATCTCCCCTGCCCAGAAGG - Intergenic
1021756802 7:23859970-23859992 TCTAATCTCCCCTGCCCAGAAGG - Intergenic
1022413126 7:30154770-30154792 TCTCCTCTCCCCTTTCCAGAAGG + Intronic
1023078036 7:36502652-36502674 TCTAATCTCCCCCACCCAGAAGG - Intergenic
1024735204 7:52296924-52296946 TCTAATCTCCCCCACCCAGATGG + Intergenic
1026090323 7:67294107-67294129 TCAAATCTCCCTTACCCAGCTGG - Intergenic
1026872969 7:73864480-73864502 TCTAATGTTCCCTTCTCAGAAGG + Intronic
1027119916 7:75509421-75509443 TCAAATCTCCCTTACCCAGCTGG - Intergenic
1027271909 7:76526188-76526210 TCAAATCTCCCTTACCCAGCTGG + Intergenic
1027560621 7:79724407-79724429 GGTATCCTCCCCTGCCCAGATGG - Intergenic
1027791033 7:82639189-82639211 TCTAATCTCCCCCACCCAGAAGG + Intergenic
1028391738 7:90325106-90325128 TGTAATCCCAACTGCCCAGAAGG + Intergenic
1028495302 7:91454215-91454237 TCTAATCTCCCTCACCCAGAAGG - Intergenic
1029111162 7:98213643-98213665 GCTTCTCTCCCATGCCCAGAAGG - Intergenic
1029717583 7:102340603-102340625 TCAAATCTCCCTTACCCAGCTGG + Intergenic
1030420439 7:109301311-109301333 TCTAATCTCCCCCACCCAGAAGG + Intergenic
1031731699 7:125309934-125309956 TCCAATCTCCCCTGCCCAGAAGG + Intergenic
1032432948 7:131877847-131877869 TCTACTCTTCCCTGCAAAGAGGG - Intergenic
1033759331 7:144422812-144422834 TCTAATCTCCCCTGCCCAGAAGG - Intergenic
1034580056 7:152034171-152034193 TCTAATCTCCCCTGCCCAGAAGG - Intronic
1036784412 8:11676560-11676582 ACTATTATCCCATGCCCAGAGGG + Intergenic
1038430871 8:27498291-27498313 TCTAATCTCCCCCACTCAGAAGG - Intronic
1038638703 8:29307089-29307111 TCTAATCTCCCCTGCCCAGAAGG + Intergenic
1039275917 8:35934117-35934139 TCTAATCTTCCCCACCCAGAAGG + Intergenic
1039506263 8:38054630-38054652 TACAATCTCTCCTCCCCAGAGGG - Intronic
1039590903 8:38746096-38746118 TGTAAGCTCTCCTGCCCAGCCGG + Intronic
1039693260 8:39883385-39883407 TCTAATCTCCCTTGCCCAGAAGG - Intergenic
1039999762 8:42566043-42566065 TGTAATCTCCCCTGCCCAGAAGG - Intergenic
1040527127 8:48235153-48235175 TCTAATCTTCCCCACCCAGAAGG + Intergenic
1040667957 8:49654894-49654916 TCTAATCTCCCCTGCCCAGAAGG - Intergenic
1040953303 8:52956751-52956773 TCTAATCTCCCCTGCCCAGAAGG + Intergenic
1040965140 8:53074986-53075008 TTTAATCTCTCCTGCCCAGAAGG - Intergenic
1041000017 8:53440750-53440772 TCTAATCTCCCCAGCTCAGAAGG - Intergenic
1041001826 8:53461692-53461714 TCTAATCTCCCCAGCTCAGAAGG + Intergenic
1041218199 8:55622657-55622679 TCTTATCTCTTCTCCCCAGATGG - Intergenic
1042771821 8:72390062-72390084 TCTAATCTCCCCGACCCAGAAGG + Intergenic
1042919527 8:73908124-73908146 TCTAATCTCTCCCACCCAGAAGG + Intergenic
1043256978 8:78149723-78149745 TCTAATCTCCCTCACCCAGAAGG + Intergenic
1044005525 8:86932404-86932426 TCTAATCTCCCCCACCCAGAAGG - Intronic
1044159509 8:88895848-88895870 TCTAATCTCCTCTGCTCCCAGGG - Intergenic
1044456712 8:92398781-92398803 TCTAATCTCCCCCGCCCAGAAGG - Intergenic
1045858461 8:106790668-106790690 TCTAATCTCCCCCGCCAGGAAGG + Intergenic
1047667342 8:127106285-127106307 TCTAATCTCCCCTGTGCAGCTGG + Intergenic
1050315046 9:4392509-4392531 TTCAATCTCCCTTCCCCAGAAGG - Intergenic
1050472609 9:6008199-6008221 TCTCCTCTCCCCTCCCCGGAGGG + Intergenic
1051871022 9:21737921-21737943 TCTGGTCTCCCCAACCCAGATGG + Intergenic
1051935186 9:22436651-22436673 TCTAATCTCTCCTGCCCAGAAGG + Intergenic
1052057856 9:23923762-23923784 TCTAATCTCCCCTGCCCAGAAGG - Intergenic
1053433567 9:38059864-38059886 TGTAATCTCCCCTTTGCAGATGG - Intronic
1053709608 9:40792542-40792564 TCTAATCCCACCTGCTCAGGAGG + Intergenic
1054419512 9:64913330-64913352 TCTAATCCCACCTGCTCAGGAGG + Intergenic
1054967678 9:71048365-71048387 TCTAATCTACACTGCCCAGCAGG + Intronic
1055458371 9:76493635-76493657 TCTAATCTCCCCCGCCCAGAAGG - Intronic
1056392872 9:86155165-86155187 TCTAATCTCCCCCACCCAGAAGG - Intergenic
1058201685 9:102050132-102050154 TCAAATCTCACCTTCCCAGTGGG + Intergenic
1059796561 9:117703878-117703900 TCTAATCTCCCCTTCTTATAAGG - Intergenic
1060955358 9:127635035-127635057 TGTAATCTCAGCTGCTCAGAAGG - Intronic
1188097432 X:26042223-26042245 TCTAATCTCCCCCACCCAGAAGG + Intergenic
1188136431 X:26499578-26499600 TCTAATCTCCCCTGCCCAGAAGG + Intergenic
1189187569 X:39067268-39067290 TCTATGCTCCCATGCCTAGAAGG - Intergenic
1190541368 X:51481729-51481751 TCTAATCTCCCCTGCCCAGAAGG + Intergenic
1192482856 X:71500084-71500106 TCTAATCTCCCCCACCCAGAAGG - Intronic
1192792999 X:74401961-74401983 TCTAATCTCCTCTTCCTATAAGG - Intergenic
1192870105 X:75176643-75176665 TCTAATCTCCCCTGCCCAAAAGG - Intergenic
1192935627 X:75856231-75856253 TATATTCTCTCCTGCCCATAAGG - Intergenic
1194624806 X:96214986-96215008 TCTGAGATGCCCTGCCCAGAGGG - Intergenic
1195109316 X:101629838-101629860 CCTTATCTGCCCTGCCCCGAGGG + Intergenic
1195439480 X:104884862-104884884 TCTAATCTCCCCTGCCCAGAAGG + Intronic
1195552478 X:106184907-106184929 TCTAATCTCCCCCACCCAGAAGG - Intronic
1195747916 X:108137269-108137291 CCTAAGCTCCCCTGCCCTGGTGG - Intronic
1196127440 X:112114686-112114708 TCTAATCTCCCCTGCCCAGAAGG - Intergenic
1196419477 X:115507517-115507539 TCTAATCTCCCCTGCCCAGAGGG - Intergenic
1196488895 X:116245610-116245632 TCTAATCTCCCCTGCCCAGAAGG + Intergenic
1196662036 X:118279812-118279834 TCTAATCTCCCCTGCCCAGAAGG - Intergenic
1197513314 X:127397121-127397143 TCTAATCTCCCCTGCCCAGAAGG + Intergenic
1199075060 X:143516642-143516664 GCTAAACTCCCCTGTCCAGGCGG + Intronic
1199829049 X:151530808-151530830 TCTAATTTTTCCTGTCCAGAAGG + Intergenic
1199832500 X:151560106-151560128 TCTAATCTCCCCTGCCCAGAAGG - Intergenic
1200085389 X:153601734-153601756 TCTCATCACCCCGGCTCAGATGG + Intergenic
1200711191 Y:6486387-6486409 TCTAATCTCCTCCTCCCAGAAGG + Intergenic
1200776137 Y:7171898-7171920 TCTAATCTCCTCCACCCAGAAGG + Intergenic
1200801108 Y:7387760-7387782 TCTAATCTCCCCCACCCAGAAGG - Intergenic
1200880886 Y:8210282-8210304 TCTAATCTCCCCCACCCAGAAGG - Intergenic
1200959231 Y:8981977-8981999 TCTAATCTCCTCTGCTCAGAAGG + Intergenic
1200966685 Y:9045394-9045416 GCTAATCTCCCTTGCCCAGAAGG + Intergenic
1201022745 Y:9675599-9675621 TCTAATCTCCTCCTCCCAGAAGG - Intergenic
1201070705 Y:10145262-10145284 TCTTAAATCCCCTGCCCGGAAGG + Intergenic
1201403685 Y:13629918-13629940 TCTAATCTCCCCCACCCAGAAGG + Intergenic
1201407595 Y:13664242-13664264 TCTAATATCCCCCACCCAGAAGG - Intergenic
1201429608 Y:13891058-13891080 TCTAATCTCTCCCACCCAGAAGG + Intergenic
1201468748 Y:14312345-14312367 TCTAATCTCCCCTGCCCAGAAGG + Intergenic
1201487491 Y:14508429-14508451 TCTAATCTCCCCTGCCCAGAAGG + Intergenic
1201496489 Y:14595290-14595312 TCTAATCTCCCCTGCCCGGAAGG - Intronic
1201516065 Y:14819601-14819623 TCTAGTCTCCCCCACCCAGAAGG - Intronic
1201530472 Y:14985571-14985593 TCTAATCTCCCCCACACAGAAGG + Intergenic
1201555645 Y:15262831-15262853 TCTAATCTCCCCTGCCCAGAAGG + Intergenic
1201568661 Y:15391717-15391739 TCTAATCTCCCCTTCCCAGAAGG - Intergenic
1201631174 Y:16073365-16073387 TCTAATCTCCCCTGCCCAGAAGG + Intergenic
1201648975 Y:16264793-16264815 TCTAATCTCCCCTACCCAGAAGG - Intergenic
1201653834 Y:16320507-16320529 TCTAATCTCCCCTACCCAGAAGG + Intergenic
1201729670 Y:17190537-17190559 TCTAATCTCCCCCACCCAGAAGG - Intergenic
1201744070 Y:17351835-17351857 TCTAATCTTCCCCATCCAGAAGG - Intergenic
1201911019 Y:19133635-19133657 TTTAATCTCCCCCTCCCAGAAGG + Intergenic
1201989603 Y:20009378-20009400 TCTAATCTCCCCTTCCCAGAAGG - Intergenic
1202074786 Y:21026991-21027013 TCTAACCTCCCCTGCCCAGGAGG - Intergenic
1202089948 Y:21178910-21178932 TCTAATCTCCCCTTCCCAGAAGG - Intergenic
1202146773 Y:21806783-21806805 ACTAAACTCCTCTGCCCAGAGGG - Intergenic
1202192697 Y:22260750-22260772 TCTAATCTCCCCTGCCCACAAGG - Intergenic
1202242797 Y:22788262-22788284 TCTTATCTCCCCTGCCCAGAAGG + Intergenic
1202257740 Y:22939117-22939139 TCTAATCTCCCCTGCCCAGAAGG + Intergenic
1202272148 Y:23082820-23082842 TCTAATCTCCCCTGCCCAGAAGG - Intergenic
1202293878 Y:23337862-23337884 TCTAATCTCCCCTGCCCAGAAGG + Intergenic
1202395784 Y:24422012-24422034 TCTTATCTCCCCTGCCCAGAAGG + Intergenic
1202410730 Y:24572864-24572886 TCTAATCTCCCCTGCCCAGAAGG + Intergenic
1202425145 Y:24716564-24716586 TCTAATCTCCCCTGCCCAGAAGG - Intergenic
1202445644 Y:24953521-24953543 TCTAATCTCCCCTGCCCAGAAGG + Intergenic
1202460051 Y:25097208-25097230 TCTAATCTCCCCTGCCCAGAAGG - Intergenic
1202475001 Y:25248080-25248102 TCTTATCTCCCCTGCCCAGAAGG - Intergenic